Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1orf130 cdna clone

C1orf130 cDNA Clone

Gene Names
NCMAP; MP11; C1orf130
Synonyms
C1orf130; C1orf130 cDNA Clone; C1orf130 cdna clone
Ordering
For Research Use Only!
Sequence
ATGACCACAGCCACCCCTCTGGGGGATACCACCTTCTTCTCACTGAACATGACCACCAGGGGAGAAGACTTCCTGTATAAGAGTTCTGGAGCCATTGTTGCTGCCGTTGTGGTGGTTGTCATCATCATCTTCACCGTGGTTCTGATCCTGCTGAAGATGTACAACAGGAAAATGAGGACGAGGCGGGAACTAGAGCCCAAGGGCCCCAAGCCAACCGCCCCTTCTGCCGTGGGCCCAAACAGCAACGGCAGCCAACACCCAGCAACTGTGACCTTCAGTCCTGTTGACGTCCAGGTGGAGACGCGATGA
Sequence Length
309
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,082 Da
NCBI Official Full Name
Homo sapiens chromosome 1 open reading frame 130, mRNA
NCBI Official Synonym Full Names
non-compact myelin associated protein
NCBI Official Symbol
NCMAP
NCBI Official Synonym Symbols
MP11; C1orf130
NCBI Protein Information
noncompact myelin-associated protein
UniProt Protein Name
Noncompact myelin-associated protein
UniProt Gene Name
NCMAP
UniProt Synonym Gene Names
C1orf130; MP11
UniProt Entry Name
NCMAP_HUMAN

Uniprot Description

NCMAP: Plays a role in myelin formation.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: integral to plasma membrane; paranode region of axon

Molecular Function: structural constituent of myelin sheath

Biological Process: myelin formation in the peripheral nervous system; positive regulation of myelination

Research Articles on C1orf130

Similar Products

Product Notes

The C1orf130 ncmap (Catalog #AAA1269052) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGACCACAG CCACCCCTCT GGGGGATACC ACCTTCTTCT CACTGAACAT GACCACCAGG GGAGAAGACT TCCTGTATAA GAGTTCTGGA GCCATTGTTG CTGCCGTTGT GGTGGTTGTC ATCATCATCT TCACCGTGGT TCTGATCCTG CTGAAGATGT ACAACAGGAA AATGAGGACG AGGCGGGAAC TAGAGCCCAA GGGCCCCAAG CCAACCGCCC CTTCTGCCGT GGGCCCAAAC AGCAACGGCA GCCAACACCC AGCAACTGTG ACCTTCAGTC CTGTTGACGT CCAGGTGGAG ACGCGATGA. It is sometimes possible for the material contained within the vial of "C1orf130, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.