Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C16orf89 cdna clone

C16orf89 cDNA Clone

Synonyms
C16orf89; C16orf89 cDNA Clone; C16orf89 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgccagggggaggtgggaaggaggtgggaggagggcgtgcagaggcagtctgggcttggccagagctcagggtgctgagcgtgtgaccagcagtgagcagaggccggccatggccagcctggggctgctgctcctgctcttactgacagcactgccaccgctgtggtcctcctcactgcctgggctggacactgctgaaagtaaagccaccattgcagacctgatcctgtctgcgctggagagagccaccgtcttcctagaacagaggctgcctgaaatcaacctggatggcatggtgggggtccgagtgctggaagagcagctaaaaagtgtccgggagaagtgggcccaggagcccctgctgcagccgctgagcctgcgcgtggggatgctgggggagaagctggaggctgccatccagagatccctccactacctcaagctgagtgatcccaagtacctaagagagttccagctgaccctccagcccgggttttggaagctcccacatgcctggatccacactgatgcctccttggtgtaccccacgttcgggccccaggactcattctcagaggagagaagtgacgtgtgcctggtgcagctgctgggaaccgggacggacagcagcgagccctgcggcctctcagacctctgcaggagcctcatgaccaagcccggctgctcaggctactgcctgtcccaccaactgctcttcttcctctgggccagaatgaggggatgcacacaggcaccactccaacagagccaggactatatcaacctcttctgcgccaacatgatggacttgaaccgcagagctgaggccatcggatacgcctaccctacccgggacatcttcatggaaaacatcatgttctgtggaatgggcggcttctccgacttctacaagctccggtggctggaggccattctcagctggcagaaacagcaggaaggatgcttcggggagcctgatgctgaagatgaagaatcatctaaagctattcaatatcagcagcatttttcgaggagagtgaagaggcgagaaaaacaatttccagatggctgctcctcccacaacacagccacagcagtggcagccctgggtggcttcctatacatcctggcagaataccccccagcaaacagagagccacacccatccacaccgccaccaccaagcagccgctga
Sequence Length
1200
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,613 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 89, mRNA
NCBI Official Synonym Full Names
chromosome 16 open reading frame 89
NCBI Official Symbol
C16orf89
NCBI Protein Information
UPF0764 protein C16orf89
UniProt Protein Name
UPF0764 protein C16orf89
Protein Family
UniProt Gene Name
C16orf89
UniProt Entry Name
CP089_HUMAN

NCBI Description

This gene is expressed predominantly in the thyroid. Based on expression patterns similar to thyroid transcription factors and proteins, this gene may function in the development and function of the thyroid. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

MGC45438: expressed predominantly in the thyroid. Based on expression patterns similar to thyroid transcription factors and proteins, this gene may function in the development and function of the thyroid. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytosol; membrane

Molecular Function: protein homodimerization activity

Biological Process: skeletal muscle fiber development

Research Articles on C16orf89

Similar Products

Product Notes

The C16orf89 c16orf89 (Catalog #AAA1272222) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcca gggggaggtg ggaaggaggt gggaggaggg cgtgcagagg cagtctgggc ttggccagag ctcagggtgc tgagcgtgtg accagcagtg agcagaggcc ggccatggcc agcctggggc tgctgctcct gctcttactg acagcactgc caccgctgtg gtcctcctca ctgcctgggc tggacactgc tgaaagtaaa gccaccattg cagacctgat cctgtctgcg ctggagagag ccaccgtctt cctagaacag aggctgcctg aaatcaacct ggatggcatg gtgggggtcc gagtgctgga agagcagcta aaaagtgtcc gggagaagtg ggcccaggag cccctgctgc agccgctgag cctgcgcgtg gggatgctgg gggagaagct ggaggctgcc atccagagat ccctccacta cctcaagctg agtgatccca agtacctaag agagttccag ctgaccctcc agcccgggtt ttggaagctc ccacatgcct ggatccacac tgatgcctcc ttggtgtacc ccacgttcgg gccccaggac tcattctcag aggagagaag tgacgtgtgc ctggtgcagc tgctgggaac cgggacggac agcagcgagc cctgcggcct ctcagacctc tgcaggagcc tcatgaccaa gcccggctgc tcaggctact gcctgtccca ccaactgctc ttcttcctct gggccagaat gaggggatgc acacaggcac cactccaaca gagccaggac tatatcaacc tcttctgcgc caacatgatg gacttgaacc gcagagctga ggccatcgga tacgcctacc ctacccggga catcttcatg gaaaacatca tgttctgtgg aatgggcggc ttctccgact tctacaagct ccggtggctg gaggccattc tcagctggca gaaacagcag gaaggatgct tcggggagcc tgatgctgaa gatgaagaat catctaaagc tattcaatat cagcagcatt tttcgaggag agtgaagagg cgagaaaaac aatttccaga tggctgctcc tcccacaaca cagccacagc agtggcagcc ctgggtggct tcctatacat cctggcagaa taccccccag caaacagaga gccacaccca tccacaccgc caccaccaag cagccgctga. It is sometimes possible for the material contained within the vial of "C16orf89, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.