Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C15orf44 cdna clone

C15orf44 cDNA Clone

Gene Names
VWA9; C15orf44
Synonyms
C15orf44; C15orf44 cDNA Clone; C15orf44 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgacagtggtggtaatggatgtatccctttccatgacccgacctgtgtctattgaggggtccgaggaataccagcgtaagcacctagcagcccatggtttaacgatgctgtttgagcacatggccacaaattacaagcttgaatttacagcacttgtggttttttcatcactttgggagttgatggtccccttcacgagagattataataccctacaggaagcactaagtaatatggatgattatgacaaaacctgcttggagtctgcattagttggtgtttgcaatatcgttcagcaagaatggggtggtgcaattccttgccaggttgtcctggtgacagacggctgtcttggcattggtagagggtcactgcgacattccctagccactcaaaatcaacgaagtgagagcaacaggtttccactaccttttcctttcccatctaagttatatatcatgtgcatggcgaatttggaggagctccagagcaccgattccttggaatgccttgaacgtctcatagatttaaacaatggtgaagggcagatttttactattgatggccccctgtgcttgaagaatgtacagtctatgtttggaaaactgatagatttggcatatacgcctttccatgctgttctcaagtgtggccacctaactgctgatgtacaagtcttccccaggccagaaccttttgttgtagatgaagaaattgatcctatccctaaagtcattaacacagatttggaaatagtgggatttattgatatagctgatatttcaagtcccccagttctgtccagacatctggtcttacctatagcacttaacaaagaaggtgatgaggtgggtactggcatcactgatgacaatgaagatgaaaattcagccaatcagattgcaggcaaaatacccaacttttgtgtcctgctccatggtagcctaaaagtggaaggaatggtagcgattgttcaattaggtcctgaatggcatggaatgctctactcccaagctgacagcaagaagaaatcaaacctcatgatgtctctctttgagcctggcccagaacctctcccatggctagggaaaatggcacagttgggtcctatttcagatgctaaagaaaacccttatggcgaggatgacaataagagtccattccccctgcagcccaaaaacaaacgcagttatgcccagaatgtgactgtctggatcaaacccagcggcctgcagacagatgtacagaagattttaagaaatgcaaggaaactacctgaaaaaacacagacattctataaggagctgaaccgtttgcgaaaggccgctctagcctttggtttcctggacctgctgaaaggggtggctgacatgctggaaagggaatgcacactgctgcctgagacagcccaccctgatgctgcattccagctgacccatgctgcccagcagctcaagctggccagtaccggcacctctgagtatgccgcttatgaccagaacatcacacctttgcacacggacttctctgggagcagcactgaaagaatttga
Sequence Length
1557
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,734 Da
NCBI Official Full Name
Homo sapiens chromosome 15 open reading frame 44, mRNA
NCBI Official Synonym Full Names
von Willebrand factor A domain containing 9
NCBI Official Symbol
VWA9
NCBI Official Synonym Symbols
C15orf44
NCBI Protein Information
von Willebrand factor A domain-containing protein 9
UniProt Protein Name
von Willebrand factor A domain-containing protein 9
UniProt Gene Name
VWA9
UniProt Synonym Gene Names
C15orf44
UniProt Entry Name
VWA9_HUMAN

Uniprot Description

VWA9: Belongs to the UPF0464 family. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 15q22.31

Cellular Component: nucleoplasm

Biological Process: snRNA transcription from RNA polymerase II promoter

Similar Products

Product Notes

The C15orf44 vwa9 (Catalog #AAA1266077) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgacag tggtggtaat ggatgtatcc ctttccatga cccgacctgt gtctattgag gggtccgagg aataccagcg taagcaccta gcagcccatg gtttaacgat gctgtttgag cacatggcca caaattacaa gcttgaattt acagcacttg tggttttttc atcactttgg gagttgatgg tccccttcac gagagattat aataccctac aggaagcact aagtaatatg gatgattatg acaaaacctg cttggagtct gcattagttg gtgtttgcaa tatcgttcag caagaatggg gtggtgcaat tccttgccag gttgtcctgg tgacagacgg ctgtcttggc attggtagag ggtcactgcg acattcccta gccactcaaa atcaacgaag tgagagcaac aggtttccac taccttttcc tttcccatct aagttatata tcatgtgcat ggcgaatttg gaggagctcc agagcaccga ttccttggaa tgccttgaac gtctcataga tttaaacaat ggtgaagggc agatttttac tattgatggc cccctgtgct tgaagaatgt acagtctatg tttggaaaac tgatagattt ggcatatacg cctttccatg ctgttctcaa gtgtggccac ctaactgctg atgtacaagt cttccccagg ccagaacctt ttgttgtaga tgaagaaatt gatcctatcc ctaaagtcat taacacagat ttggaaatag tgggatttat tgatatagct gatatttcaa gtcccccagt tctgtccaga catctggtct tacctatagc acttaacaaa gaaggtgatg aggtgggtac tggcatcact gatgacaatg aagatgaaaa ttcagccaat cagattgcag gcaaaatacc caacttttgt gtcctgctcc atggtagcct aaaagtggaa ggaatggtag cgattgttca attaggtcct gaatggcatg gaatgctcta ctcccaagct gacagcaaga agaaatcaaa cctcatgatg tctctctttg agcctggccc agaacctctc ccatggctag ggaaaatggc acagttgggt cctatttcag atgctaaaga aaacccttat ggcgaggatg acaataagag tccattcccc ctgcagccca aaaacaaacg cagttatgcc cagaatgtga ctgtctggat caaacccagc ggcctgcaga cagatgtaca gaagatttta agaaatgcaa ggaaactacc tgaaaaaaca cagacattct ataaggagct gaaccgtttg cgaaaggccg ctctagcctt tggtttcctg gacctgctga aaggggtggc tgacatgctg gaaagggaat gcacactgct gcctgagaca gcccaccctg atgctgcatt ccagctgacc catgctgccc agcagctcaa gctggccagt accggcacct ctgagtatgc cgcttatgac cagaacatca cacctttgca cacggacttc tctgggagca gcactgaaag aatttga. It is sometimes possible for the material contained within the vial of "C15orf44, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.