C14orf135 cdna clone
C14orf135 cDNA Clone
Gene Names
PCNX4; FBP2; PCNXL4; C14orf135
Synonyms
C14orf135; C14orf135 cDNA Clone; C14orf135 cdna clone
Sequence
atgccatatattcctctcatggagttcagttgttcacattctcacttagtatgcttacccgcagagtggaggactagctgtatgcccagttccaaaatgaaggagatgagctcgttatttccagaagactggtaccaatttgttctaaggcagttggaatgttatcattcagaagagaaggcctcaaatgtactggaagaaattgccaaggacaaagttttaaaagacttttatgttcatacagtaatgacttgttattttagtttatttggaatagacaatatggctcctagtcctggtcatatattgagagtttacggtggtgttttgccttggtctgttgctttggactggctcacagaaaagccagaactgtttcaactagcactgaaagcattcaggtatactctgaaactaatgattgataaagcaagtttaggtccaatagaagactttagagaactgattaagtaccttgaagaatatgaacgtgactggtacattggtttggtatctgatgaaaagtggaaggaagcaattttacaagaaaagccatacttgttttctctggggtatgattctaatatgggaatttacactgggagagtgcttagccttcaagaattattgatccaagtgggaaagttaaatcctgaagctgttagaggtcagtgggccaatctttcatgggaattactttatgccacaaacgatgatgaagaacgttatagtatacaagctcatccactacttttaagaaatcttacggtacaagcagcagaacctcccctgggatatccgatttattcttcaaaacctctccacatacatttgtattag
Sequence Length
840
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
132,702 Da
NCBI Official Full Name
Homo sapiens chromosome 14 open reading frame 135, mRNA
NCBI Official Synonym Full Names
pecanex homolog 4 (Drosophila)
NCBI Official Symbol
PCNX4
NCBI Official Synonym Symbols
FBP2; PCNXL4; C14orf135
NCBI Protein Information
pecanex-like protein 4
UniProt Protein Name
Pecanex-like protein 4
UniProt Gene Name
PCNX4
UniProt Synonym Gene Names
HCV F protein-binding protein 2
UniProt Entry Name
PCX4_HUMAN
Uniprot Description
PCNXL4: Belongs to the pecanex family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 14q23.1
Molecular Function: protein binding
Similar Products
Product Notes
The C14orf135 pcnx4 (Catalog #AAA1277497) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccatata ttcctctcat ggagttcagt tgttcacatt ctcacttagt atgcttaccc gcagagtgga ggactagctg tatgcccagt tccaaaatga aggagatgag ctcgttattt ccagaagact ggtaccaatt tgttctaagg cagttggaat gttatcattc agaagagaag gcctcaaatg tactggaaga aattgccaag gacaaagttt taaaagactt ttatgttcat acagtaatga cttgttattt tagtttattt ggaatagaca atatggctcc tagtcctggt catatattga gagtttacgg tggtgttttg ccttggtctg ttgctttgga ctggctcaca gaaaagccag aactgtttca actagcactg aaagcattca ggtatactct gaaactaatg attgataaag caagtttagg tccaatagaa gactttagag aactgattaa gtaccttgaa gaatatgaac gtgactggta cattggtttg gtatctgatg aaaagtggaa ggaagcaatt ttacaagaaa agccatactt gttttctctg gggtatgatt ctaatatggg aatttacact gggagagtgc ttagccttca agaattattg atccaagtgg gaaagttaaa tcctgaagct gttagaggtc agtgggccaa tctttcatgg gaattacttt atgccacaaa cgatgatgaa gaacgttata gtatacaagc tcatccacta cttttaagaa atcttacggt acaagcagca gaacctcccc tgggatatcc gatttattct tcaaaacctc tccacataca tttgtattag. It is sometimes possible for the material contained within the vial of "C14orf135, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
