Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C12orf53 cdna clone

C12orf53 cDNA Clone

Gene Names
PIANP; PANP; LEDA1; leda-1; C12orf53
Synonyms
C12orf53; C12orf53 cDNA Clone; C12orf53 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtccaggatgtggcctgcgctgctgctgtcccacctcctccctctctggccactgctgttgctgcccctcccaccgcctgctcagggctcttcatcctcccctcgaaccccaccagccccagcccgccccccgtgtgccaggggaggcccctcggccccacgtcatgtgtgcgtgtgggagcgagcacctccaccaagccgatctcctcgggtcccaagatcacgtcggcaagtcctgcctggcactgcacccccagccaccccatcaggctttgaggaggggccgccctcatcccaatacccctgggctatcgtgtggggtcccaccgtgtctcgagaggatggaggggaccccaactctgccaatcccggatttctggactatggttttgcagcccctcatgggctcgcaaccccacaccccaactcagactccatgcgaggtgatggagatgggcttatccttggagaggcacctgccaccctgcggccattcctgttcgggggccgtggggaaggtgtggacccccagctctatgtcacaattaccatctccatcatcattgttctcgtggccactggcatcatcttcaagttctgctgggaccgcagccagaagcgacgcagaccctcagggcagcaaggtgccctgaggcaggaggagagccagcagccactgacagacctgtccccggctggagtcactgtgctgggggccttcggggactcacctacccccacccctgaccatgaggagccccgagggggaccccggcctgggatgccccaccccaagggggctccagccttccagttgaaccggattcccctggtgaatctgtga
Sequence Length
849
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,426 Da
NCBI Official Full Name
Homo sapiens chromosome 12 open reading frame 53, mRNA
NCBI Official Synonym Full Names
PILR alpha associated neural protein
NCBI Official Symbol
PIANP
NCBI Official Synonym Symbols
PANP; LEDA1; leda-1; C12orf53
NCBI Protein Information
PILR alpha-associated neural protein
UniProt Protein Name
PILR alpha-associated neural protein
UniProt Gene Name
PIANP
UniProt Synonym Gene Names
C12orf53; PANP
UniProt Entry Name
PIANP_HUMAN

NCBI Description

This gene encodes a ligand for the paired immunoglobin-like type 2 receptor alpha, and so may be involved in immune regulation. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Sep 2011]

Uniprot Description

PIANP: Acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.31

Cellular Component: adherens junction; basolateral plasma membrane

Research Articles on C12orf53

Similar Products

Product Notes

The C12orf53 pianp (Catalog #AAA1267676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcca ggatgtggcc tgcgctgctg ctgtcccacc tcctccctct ctggccactg ctgttgctgc ccctcccacc gcctgctcag ggctcttcat cctcccctcg aaccccacca gccccagccc gccccccgtg tgccagggga ggcccctcgg ccccacgtca tgtgtgcgtg tgggagcgag cacctccacc aagccgatct cctcgggtcc caagatcacg tcggcaagtc ctgcctggca ctgcaccccc agccacccca tcaggctttg aggaggggcc gccctcatcc caatacccct gggctatcgt gtggggtccc accgtgtctc gagaggatgg aggggacccc aactctgcca atcccggatt tctggactat ggttttgcag cccctcatgg gctcgcaacc ccacacccca actcagactc catgcgaggt gatggagatg ggcttatcct tggagaggca cctgccaccc tgcggccatt cctgttcggg ggccgtgggg aaggtgtgga cccccagctc tatgtcacaa ttaccatctc catcatcatt gttctcgtgg ccactggcat catcttcaag ttctgctggg accgcagcca gaagcgacgc agaccctcag ggcagcaagg tgccctgagg caggaggaga gccagcagcc actgacagac ctgtccccgg ctggagtcac tgtgctgggg gccttcgggg actcacctac ccccacccct gaccatgagg agccccgagg gggaccccgg cctgggatgc cccaccccaa gggggctcca gccttccagt tgaaccggat tcccctggtg aatctgtga. It is sometimes possible for the material contained within the vial of "C12orf53, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.