C11orf68 cdna clone
C11orf68 cDNA Clone
Gene Names
C11orf68; P5326; BLES03
Synonyms
C11orf68; C11orf68 cDNA Clone; C11orf68 cdna clone
Sequence
atggaaccaggtgaggagctggaagaggagggctctccaggtggccgtgaggatggcttcaccgccgagcacctggctgcagaggccatggcagctgacatggacccctggctagtgtttgatgcccgcacaacgcctgccactgagctggatgcctggctggccaagtacccaccatcccaagttacccgctatggggaccccggttcacccaactcagagcctgtgggctggattgcagtgtatgggcagggctacagccccaactccggggacgtgcagggcctgcaggcagcctgggaagctctgcagaccagtgggcggcccatcacaccgggtaccctgcgccagctcgccatcacccaccacgtgctctcgggcaagtggcttatgcatctggcaccgggcttcaagctggaccacgcctgggctggcattgcccgggccgtggttgaaggccggcttcaggtggccaaggtgagcccacgtgccaaggagggtgggcgccaggtcatctgtgtttacacggacgacttcacggaccgcttgggtgtactggaggcggattcagccatccgtgcagcgggcattaagtgcctgctcacctacaagcctgatgtctacacctacctgggcatctaccgggccaatcgctggcacctctgccccactctctatgagagccgtttccagcttgggggtagtgcccgtggctcccgagtgcttgaccgtgccaacaacgtggaactgacctag
Sequence Length
756
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,517 Da
NCBI Official Full Name
Homo sapiens chromosome 11 open reading frame 68, mRNA
NCBI Official Synonym Full Names
chromosome 11 open reading frame 68
NCBI Official Symbol
C11orf68
NCBI Official Synonym Symbols
P5326; BLES03
NCBI Protein Information
UPF0696 protein C11orf68
UniProt Protein Name
UPF0696 protein C11orf68
Protein Family
UniProt Gene Name
C11orf68
UniProt Synonym Gene Names
BLES03
UniProt Entry Name
CK068_HUMAN
Uniprot Description
BLES03 iso3: Belongs to the UPF0696 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 11q13.1
Molecular Function: protein binding
Research Articles on C11orf68
Similar Products
Product Notes
The C11orf68 c11orf68 (Catalog #AAA1271554) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaccag gtgaggagct ggaagaggag ggctctccag gtggccgtga ggatggcttc accgccgagc acctggctgc agaggccatg gcagctgaca tggacccctg gctagtgttt gatgcccgca caacgcctgc cactgagctg gatgcctggc tggccaagta cccaccatcc caagttaccc gctatgggga ccccggttca cccaactcag agcctgtggg ctggattgca gtgtatgggc agggctacag ccccaactcc ggggacgtgc agggcctgca ggcagcctgg gaagctctgc agaccagtgg gcggcccatc acaccgggta ccctgcgcca gctcgccatc acccaccacg tgctctcggg caagtggctt atgcatctgg caccgggctt caagctggac cacgcctggg ctggcattgc ccgggccgtg gttgaaggcc ggcttcaggt ggccaaggtg agcccacgtg ccaaggaggg tgggcgccag gtcatctgtg tttacacgga cgacttcacg gaccgcttgg gtgtactgga ggcggattca gccatccgtg cagcgggcat taagtgcctg ctcacctaca agcctgatgt ctacacctac ctgggcatct accgggccaa tcgctggcac ctctgcccca ctctctatga gagccgtttc cagcttgggg gtagtgcccg tggctcccga gtgcttgacc gtgccaacaa cgtggaactg acctag. It is sometimes possible for the material contained within the vial of "C11orf68, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
