Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BVES cdna clone

BVES cDNA Clone

Gene Names
BVES; POP1; HBVES; LGMD2X; POPDC1
Synonyms
BVES; BVES cDNA Clone; BVES cdna clone
Ordering
For Research Use Only!
Sequence
atgaattatacagagtccagcccattgagagaatcaactgccataggttttacacctgagttagaaagtatcatacctgtgccttccaataagaccacttgtgaaaactggagagagatacatcatctggtttttcatgtagcaaatatttgttttgcagttgggttggttattccaactactcttcaccttcatatgatatttcttaggggaatgttaactctaggatgtaccctttatatcgtctgggccactctctaccgatgtgccttggatataatgatctggaactctgtgttcttgggtgtcaacattttgcatctgtcgtatcttttatacaagaagagaccggtaaagattgaaaaggaactcagtggcatgtaccggcgattgtttgaaccactccgtgtgcctccagatttgttcagaagactaactggacagttttgcatgatccaaaccttgaaaaagggccaaacttatgctgcagaggataaaacctcagttgatgaccgtctgagtattctcttgaagggaaaaatgaaggtctcctatcgaggacattttctgcataacatttacccctgtgcctttatagattctcctgaatttagatcaactcagatgcacaaaggtgaaaaattccaggtcaccattattgcagatgataactgcagatttttatgctggtcaagagaaagattaacatactttctggaatcagaacctttcttgtatgaaatctttaggtatcttattggaaaagacatcacaaataagctctactcattgaatgatcccaccttaaatgataaaaaagccaaaaagctggaacatcagctcagcctctgcacacagatctccatgttggaaatgaggaacagtatagccagctccagtgacagtgacgacggcttgcaccagtttcttcggggtacctccagcatgtcctctcttcatgtgtcatccccacaccagcgagcctctgccaagatgaaaccgatagaagaaggagcagaagatgatgatgacgtttttgaaccggcatctccaaatacattgaaagtccatcagctgccttga
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,451 Da
NCBI Official Full Name
Homo sapiens blood vessel epicardial substance, mRNA
NCBI Official Synonym Full Names
blood vessel epicardial substance
NCBI Official Symbol
BVES
NCBI Official Synonym Symbols
POP1; HBVES; LGMD2X; POPDC1
NCBI Protein Information
blood vessel epicardial substance
UniProt Protein Name
Blood vessel epicardial substance
UniProt Gene Name
BVES
UniProt Synonym Gene Names
hBVES; Popeye protein 1
UniProt Entry Name
POPD1_HUMAN

NCBI Description

This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]

Uniprot Description

BVES: Cell adhesion molecule involved in the establishment and/or maintenance of cell integrity. Involved in the formation and regulation of the tight junction (TJ) paracellular permeability barrier in epithelial cells. Plays a role in VAMP3- mediated vesicular transport and recycling of different receptor molecules through its interaction with VAMP3. Plays a role in the regulation of cell shape and movement by modulating the Rho-family GTPase activity through its interaction with ARHGEF25/GEFT. Induces primordial adhesive contact and aggregation of epithelial cells in a Ca(2+)-independent manner. Also involved in striated muscle regeneration and repair and in the regulation of cell spreading. Belongs to the popeye family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: caveola; integral to membrane; lateral plasma membrane; plasma membrane; sarcolemma; tight junction

Molecular Function: protein binding; structural molecule activity

Biological Process: heart development; positive regulation of locomotion; positive regulation of receptor recycling; regulation of cell shape; regulation of GTPase activity; skeletal muscle development; vesicle-mediated transport

Disease: Muscular Dystrophy, Limb-girdle, Type 2x

Research Articles on BVES

Similar Products

Product Notes

The BVES bves (Catalog #AAA1270273) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattata cagagtccag cccattgaga gaatcaactg ccataggttt tacacctgag ttagaaagta tcatacctgt gccttccaat aagaccactt gtgaaaactg gagagagata catcatctgg tttttcatgt agcaaatatt tgttttgcag ttgggttggt tattccaact actcttcacc ttcatatgat atttcttagg ggaatgttaa ctctaggatg taccctttat atcgtctggg ccactctcta ccgatgtgcc ttggatataa tgatctggaa ctctgtgttc ttgggtgtca acattttgca tctgtcgtat cttttataca agaagagacc ggtaaagatt gaaaaggaac tcagtggcat gtaccggcga ttgtttgaac cactccgtgt gcctccagat ttgttcagaa gactaactgg acagttttgc atgatccaaa ccttgaaaaa gggccaaact tatgctgcag aggataaaac ctcagttgat gaccgtctga gtattctctt gaagggaaaa atgaaggtct cctatcgagg acattttctg cataacattt acccctgtgc ctttatagat tctcctgaat ttagatcaac tcagatgcac aaaggtgaaa aattccaggt caccattatt gcagatgata actgcagatt tttatgctgg tcaagagaaa gattaacata ctttctggaa tcagaacctt tcttgtatga aatctttagg tatcttattg gaaaagacat cacaaataag ctctactcat tgaatgatcc caccttaaat gataaaaaag ccaaaaagct ggaacatcag ctcagcctct gcacacagat ctccatgttg gaaatgagga acagtatagc cagctccagt gacagtgacg acggcttgca ccagtttctt cggggtacct ccagcatgtc ctctcttcat gtgtcatccc cacaccagcg agcctctgcc aagatgaaac cgatagaaga aggagcagaa gatgatgatg acgtttttga accggcatct ccaaatacat tgaaagtcca tcagctgcct tga. It is sometimes possible for the material contained within the vial of "BVES, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.