Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BTRC cdna clone

BTRC cDNA Clone

Gene Names
BTRC; FWD1; FBW1A; FBXW1; bTrCP; FBXW1A; bTrCP1; betaTrCP; BETA-TRCP
Synonyms
BTRC; BTRC cDNA Clone; BTRC cdna clone
Ordering
For Research Use Only!
Sequence
atggacccggccgaggcggtgctgcaagagaaggcactcaagtttatgtgctctatgcccaggtctctgtggctgggctgctccagcctggcggacagcatgccttcgctgcgatgcctgtataacccagggactggcgcactcacagctttccagaattcctcagagagagaagactgtaataatggcgaaccccctaggaagataataccagagaagaattcacttagacagacatacaacagctgtgccagactctgcttaaaccaagaaacagtatgtttagcaagcactgctatgaagactgagaattgtgtggccaaaacaaaacttgccaatggcacttccagtatgattgtgcccaagcaacggaaactctcagcaagctatgaaaaggaaaaggaactgtgtgtcaaatactttgagcagtggtcagagtcagatcaagtggaatttgtggaacatcttatatcccaaatgtgtcattaccaacatgggcacataaactcgtatcttaaacctatgttgcagagagatttcataactgctctgccagctcggggattggatcatattgctgagaacattctgtcatacctggatgccaaatcactatgtgctgctgaacttgtgtgcaaggaatggtaccgagtgacctctgatggcatgctgtggaagaagcttatcgagagaatggtcaggacagattctctgtggagaggcctggcagaacgaagaggatggggacagtatttattcaaaaacaaacctcctgacgggaatgctcctcccaactctttttatagagcactttatcctaaaattatacaagacattgagacaatagaatctaattggagatgtggaagacatagtttacagagaattcactgccgaagtgaaacaagcaaaggagtttactgtttacagtatgatgatcagaaaatagtaagcggccttcgagacaacacaatcaagatctgggataaaaacacattggaatgcaagcgaattctcacaggccatacaggttcagtcctctgtctccagtatgatgagagagtgatcataacaggatcatcggattccacggtcagagtgtgggatgtaaatacaggtgaaatgctaaacacgttgattcaccattgtgaagcagttctgcacttgcgtttcaataatggcatgatggtgacctgctccaaagatcgttccattgctgtatgggatatggcctccccaactgacattaccctccggagggtgctggtcggacaccgagctgctgtcaatgttgtagactttgatgacaagtacattgtttctgcatctggggatagaactataaaggtatggaacacaagtacttgtgaatttgtaaggaccttaaatggacacaaacgaggcattgcctgtttgcagtacagggacaggctggtagtgagtggctcatctgacaacactatcagattatgggacatagaatgtggtgcatgtttacgagtgttagaaggccatgaggaattggtgcgttgtattcgatttgataacaagaggatagtcagtggggcctatgatggaaaaattaaagtgtgggatcttgtggctgctttggacccccgtgctcctgcagggacactctgtctacggacccttgtggagcattccggaagagtttttcgactacagtttgatgaattccagattgtcagtagttcacatgatgacacaatcctcatctgggacttcctaaatgatccagctgcccaagctgaacccccccgttccccttctcgaacatacacctacatctccagataa
Sequence Length
1818
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,049 Da
NCBI Official Full Name
Homo sapiens beta-transducin repeat containing, mRNA
NCBI Official Synonym Full Names
beta-transducin repeat containing E3 ubiquitin protein ligase
NCBI Official Symbol
BTRC
NCBI Official Synonym Symbols
FWD1; FBW1A; FBXW1; bTrCP; FBXW1A; bTrCP1; betaTrCP; BETA-TRCP
NCBI Protein Information
F-box/WD repeat-containing protein 1A
UniProt Protein Name
F-box/WD repeat-containing protein 1A
UniProt Gene Name
BTRC
UniProt Synonym Gene Names
BTRCP; FBW1A; FBXW1A
UniProt Entry Name
FBW1A_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]

Uniprot Description

BTRC: a substrate-recognition component of the SCF (SKP1-CUL1-F-box protein) ubiquitin ligase complex, which mediates the ubiquitination of proteins involved in cell cycle progression, signal transduction and transcription. Regulates the stability of CTNNB1 and participates in Wnt signaling. Interacts directly with SKP1 in the SCF complex. Interacts specifically with phosphorylated CTNNB1 and NFKBIA, ubiquitination substrates. Two alternatively spliced isoforms have been described.

Protein type: Ubiquitin conjugating system; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 10q24.32

Cellular Component: cytosol; nucleoplasm; SCF ubiquitin ligase complex

Molecular Function: beta-catenin binding; protein binding; ubiquitin-protein ligase activity

Biological Process: G2/M transition of mitotic cell cycle; negative regulation of smoothened signaling pathway; negative regulation of transcription factor activity; negative regulation of transcription, DNA-dependent; positive regulation of circadian rhythm; positive regulation of proteolysis; positive regulation of transcription, DNA-dependent; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein amino acid dephosphorylation; protein destabilization; protein polyubiquitination; protein ubiquitination; regulation of circadian rhythm; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process; signal transduction; stimulatory C-type lectin receptor signaling pathway; stress-activated MAPK cascade; T cell receptor signaling pathway; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway

Research Articles on BTRC

Similar Products

Product Notes

The BTRC btrc (Catalog #AAA7046813) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccgg ccgaggcggt gctgcaagag aaggcactca agtttatgtg ctctatgccc aggtctctgt ggctgggctg ctccagcctg gcggacagca tgccttcgct gcgatgcctg tataacccag ggactggcgc actcacagct ttccagaatt cctcagagag agaagactgt aataatggcg aaccccctag gaagataata ccagagaaga attcacttag acagacatac aacagctgtg ccagactctg cttaaaccaa gaaacagtat gtttagcaag cactgctatg aagactgaga attgtgtggc caaaacaaaa cttgccaatg gcacttccag tatgattgtg cccaagcaac ggaaactctc agcaagctat gaaaaggaaa aggaactgtg tgtcaaatac tttgagcagt ggtcagagtc agatcaagtg gaatttgtgg aacatcttat atcccaaatg tgtcattacc aacatgggca cataaactcg tatcttaaac ctatgttgca gagagatttc ataactgctc tgccagctcg gggattggat catattgctg agaacattct gtcatacctg gatgccaaat cactatgtgc tgctgaactt gtgtgcaagg aatggtaccg agtgacctct gatggcatgc tgtggaagaa gcttatcgag agaatggtca ggacagattc tctgtggaga ggcctggcag aacgaagagg atggggacag tatttattca aaaacaaacc tcctgacggg aatgctcctc ccaactcttt ttatagagca ctttatccta aaattataca agacattgag acaatagaat ctaattggag atgtggaaga catagtttac agagaattca ctgccgaagt gaaacaagca aaggagttta ctgtttacag tatgatgatc agaaaatagt aagcggcctt cgagacaaca caatcaagat ctgggataaa aacacattgg aatgcaagcg aattctcaca ggccatacag gttcagtcct ctgtctccag tatgatgaga gagtgatcat aacaggatca tcggattcca cggtcagagt gtgggatgta aatacaggtg aaatgctaaa cacgttgatt caccattgtg aagcagttct gcacttgcgt ttcaataatg gcatgatggt gacctgctcc aaagatcgtt ccattgctgt atgggatatg gcctccccaa ctgacattac cctccggagg gtgctggtcg gacaccgagc tgctgtcaat gttgtagact ttgatgacaa gtacattgtt tctgcatctg gggatagaac tataaaggta tggaacacaa gtacttgtga atttgtaagg accttaaatg gacacaaacg aggcattgcc tgtttgcagt acagggacag gctggtagtg agtggctcat ctgacaacac tatcagatta tgggacatag aatgtggtgc atgtttacga gtgttagaag gccatgagga attggtgcgt tgtattcgat ttgataacaa gaggatagtc agtggggcct atgatggaaa aattaaagtg tgggatcttg tggctgcttt ggacccccgt gctcctgcag ggacactctg tctacggacc cttgtggagc attccggaag agtttttcga ctacagtttg atgaattcca gattgtcagt agttcacatg atgacacaat cctcatctgg gacttcctaa atgatccagc tgcccaagct gaaccccccc gttccccttc tcgaacatac acctacatct ccagataa. It is sometimes possible for the material contained within the vial of "BTRC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.