Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BTBD1 cdna clone

BTBD1 cDNA Clone

Gene Names
BTBD1; C15orf1; NS5ATP8
Synonyms
BTBD1; BTBD1 cDNA Clone; BTBD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcactcgggcctgccgcagctggggagcaggcgtcgggggctgaggcggagccgggccccgcggggccgccgccgccgccctcaccgtcctctctggggcccctgctccccctgcagcgggaacctctctacaactggcaggcgaccaaggcgtcgctgaaggagcgcttcgccttcctcttcaactcggagctgctgagcgatgtgcgcttcgtactgggcaagggtcgcggcgccgccgccgctgggggcccgcagcgcatccccgcccaccgcttcgtgctggcggccggcagcgccgtctttgacgccatgttcaacggcggcatggccaccacgtcggccgagatcgagctgccggacgtggagcccgcagccttcctggcgctgctgagatttctatattcagatgaagttcaaattggtccagaaacagttatgaccactctttatactgccaagaaatacgcagtcccagccttggaagcacactgtgtagaatttctcaccaaacatcttagggcagataatgcctttatgttacttactcaggctcgattatttgatgaacctcagcttgctagtctttgtctagatacaatagacaaaagcacaatggatgcaataagtgcagaagggtttactgatattgatatagatacactctgtgcagttttagagagagacacactcagtattcgagaaagtcgactttttggagctgttgtacgctgggcagaagcagaatgtcagagacaacaattacctgtgacttttgggaataaacaaaaagttctaggaaaagcactttccttaatccggttcccactgatgacaattgaggaatttgcagcaggtcctgctcaatctggaattttgtcagatcgtgaagtggtaaacctctttcttcattttactgtcaaccctaaaccccgagttgaatacattgaccgaccaagatgctgtctcaggggaaaggaatgctgcatcaatagattccagcaagtagaaagccgctggggttacagtgggacgagtgatcgaatcagattcacagttaatagaaggatctctatagttggatttggcttgtatggatctattcatggccctacagattatcaagtgaatatacagatcattgaatatgagaaaaagcaaaccctgggacagaatgataccggctttagttgtgatgggacagctaacacattcagggtcatgttcaaggaacccatagagatcctgcccaatgtgtgctacacagcatgtgcaacactcaaaggtccagattcccactatggcacaaaaggattgaagaaagtagtgcatgagacacctgctgcaagcaagactgtttttttcttttttagttcccctggcaataataatggcacttcaatagaagatggacaaattccagaaatcatattttatacataa
Sequence Length
1449
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,117 Da
NCBI Official Full Name
Homo sapiens BTB (POZ) domain containing 1, mRNA
NCBI Official Synonym Full Names
BTB domain containing 1
NCBI Official Symbol
BTBD1
NCBI Official Synonym Symbols
C15orf1; NS5ATP8
NCBI Protein Information
BTB/POZ domain-containing protein 1
UniProt Protein Name
BTB/POZ domain-containing protein 1
UniProt Gene Name
BTBD1
UniProt Synonym Gene Names
C15orf1; NS5ATP8; HCV NS5A-transactivated protein 8
UniProt Entry Name
BTBD1_HUMAN

NCBI Description

The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

BTBD1: Probable substrate-specific adapter of an E3 ubiquitin- protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 15q24

Cellular Component: protein complex; SCF ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of proteolysis

Research Articles on BTBD1

Similar Products

Product Notes

The BTBD1 btbd1 (Catalog #AAA1271989) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcac tcgggcctgc cgcagctggg gagcaggcgt cgggggctga ggcggagccg ggccccgcgg ggccgccgcc gccgccctca ccgtcctctc tggggcccct gctccccctg cagcgggaac ctctctacaa ctggcaggcg accaaggcgt cgctgaagga gcgcttcgcc ttcctcttca actcggagct gctgagcgat gtgcgcttcg tactgggcaa gggtcgcggc gccgccgccg ctgggggccc gcagcgcatc cccgcccacc gcttcgtgct ggcggccggc agcgccgtct ttgacgccat gttcaacggc ggcatggcca ccacgtcggc cgagatcgag ctgccggacg tggagcccgc agccttcctg gcgctgctga gatttctata ttcagatgaa gttcaaattg gtccagaaac agttatgacc actctttata ctgccaagaa atacgcagtc ccagccttgg aagcacactg tgtagaattt ctcaccaaac atcttagggc agataatgcc tttatgttac ttactcaggc tcgattattt gatgaacctc agcttgctag tctttgtcta gatacaatag acaaaagcac aatggatgca ataagtgcag aagggtttac tgatattgat atagatacac tctgtgcagt tttagagaga gacacactca gtattcgaga aagtcgactt tttggagctg ttgtacgctg ggcagaagca gaatgtcaga gacaacaatt acctgtgact tttgggaata aacaaaaagt tctaggaaaa gcactttcct taatccggtt cccactgatg acaattgagg aatttgcagc aggtcctgct caatctggaa ttttgtcaga tcgtgaagtg gtaaacctct ttcttcattt tactgtcaac cctaaacccc gagttgaata cattgaccga ccaagatgct gtctcagggg aaaggaatgc tgcatcaata gattccagca agtagaaagc cgctggggtt acagtgggac gagtgatcga atcagattca cagttaatag aaggatctct atagttggat ttggcttgta tggatctatt catggcccta cagattatca agtgaatata cagatcattg aatatgagaa aaagcaaacc ctgggacaga atgataccgg ctttagttgt gatgggacag ctaacacatt cagggtcatg ttcaaggaac ccatagagat cctgcccaat gtgtgctaca cagcatgtgc aacactcaaa ggtccagatt cccactatgg cacaaaagga ttgaagaaag tagtgcatga gacacctgct gcaagcaaga ctgttttttt cttttttagt tcccctggca ataataatgg cacttcaata gaagatggac aaattccaga aatcatattt tatacataa. It is sometimes possible for the material contained within the vial of "BTBD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.