Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BMPR1A cdna clone

BMPR1A cDNA Clone

Gene Names
BMPR1A; ALK3; SKR5; CD292; ACVRLK3; 10q23del
Synonyms
BMPR1A; BMPR1A cDNA Clone; BMPR1A cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcagctatacatttacatcagattattgggagcctatttgttcatcatttctcgtgttcaaggacagaatctggatagtatgcttcatggcactgggatgaaatcagactccgaccagaaaaagtcagaaaatggagtaaccttagcaccagaggataccttgccttttttaaagtgctattgctcagggcactgtccagatgatgctattaataacacatgcataactaatggacattgctttgccatcatagaagaagatgaccagggagaaaccacattagcttcagggtgtatgaaatatgaaggatctgattttcagtgcaaagattctccaaaagcccagctacgccggacaatagaatgttgtcggaccaatttatgtaaccagtatttgcaacccacactgccccctgttgtcataggtccgttttttgatggcagcattcgatggctggttttgctcatttctatggctgtctgcataattgctatgatcatcttctccagctgcttttgttacaaacattattgcaagagcatctcaagcagacgtcgttacaatcgtgatttggaacaggatgaagcatttattccagttggagaatcactaaaagaccttattgaccagtcacaaagttctggtagtgggtctggactacctttattggttcagcgaactattgccaaacagattcagatggtccggcaagttggtaaaggccgatatggagaagtatggatgggcaaatggcgtggcgaaaaagtggcggtgaaagtattctttaccactgaagaagccagctggtttcgagaaacagaaatctaccaaactgtgctaatgcgccatgaaaacatacttggtttcatagcggcagacattaaaggtacaggttcctggactcagctctatttgattactgattaccatgaaaatggatctctctatgacttcctgaaatgtgctacactggacaccagagccctgcttaaattggcttattcagctgcctgtggtctgtgccacctgcacacagaaatttatggcacccaaggaaagcccgcaattgctcatcgagacctaaagagcaaaaacatcctcatcaagaaaaatgggagttgctgcattgctgacctgggccttgctgttaaattcaacagtgacacaaatgaagttgatgtgcccttgaataccagggtgggcaccaaacgctacatggctcccgaagtgctggacgaaagcctgaacaaaaaccacttccagccctacatcatggctgacatctacagcttcggcctaatcatttgggagatggctcgtcgttgtatcacaggagggatcgtggaagaataccaattgccatattacaacatggtaccgagtgatccgtcatacgaagatatgcgtgaggttgtgtgtgtcaaacgtttgcggccaattgtgtctaatcggtggaacagtgatgaatgtctacgagcagttttgaagctaatgtcagaatgctgggcccacaatccagcctccagactcacagcattgagaattaagaagacgcttgccaagatggttgaatcccaagatgtaaaaatctga
Sequence Length
1599
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
657
Molecular Weight
60,198 Da
NCBI Official Full Name
Homo sapiens bone morphogenetic protein receptor, type IA, mRNA
NCBI Official Synonym Full Names
bone morphogenetic protein receptor type 1A
NCBI Official Symbol
BMPR1A
NCBI Official Synonym Symbols
ALK3; SKR5; CD292; ACVRLK3; 10q23del
NCBI Protein Information
bone morphogenetic protein receptor type-1A
UniProt Protein Name
Bone morphogenetic protein receptor type-1A
UniProt Gene Name
BMPR1A
UniProt Synonym Gene Names
ACVRLK3; ALK3; BMP type-1A receptor; BMPR-1A; ALK-3; SKR5
UniProt Entry Name
BMR1A_HUMAN

NCBI Description

The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]

Uniprot Description

BMPR1A: a serine/threonine-protein kinase receptor for Bone morphogenetic protein-2 and -4 (BMP-2 and BMP-4). Defects in BMPR1A are a cause of juvenile polyposis syndrome (JPS) and Cowden disease (CD), a cancer syndrome characterized by multiple hamartomas and by a high risk for breast, thyroid and endometriel cancers.

Protein type: Kinase, protein; Membrane protein, integral; Protein kinase, Ser/Thr (receptor); EC 2.7.11.30; Protein kinase, TKL; TKL group; STKR family; Type1 subfamily

Chromosomal Location of Human Ortholog: 10q22.3

Cellular Component: caveola; external side of plasma membrane; plasma membrane

Molecular Function: ATP binding; glycoprotein binding; protein binding; protein homodimerization activity; protein serine/threonine kinase activity; SMAD binding; transmembrane receptor protein serine/threonine kinase activity

Biological Process: BMP signaling pathway; immune response; negative regulation of smooth muscle cell migration; positive regulation of bone mineralization; positive regulation of cardiac muscle cell proliferation; positive regulation of osteoblast differentiation; positive regulation of transcription from RNA polymerase II promoter; protein amino acid phosphorylation; regulation of cardiac muscle cell proliferation; transforming growth factor beta receptor signaling pathway

Disease: Juvenile Polyposis Syndrome; Polyposis Syndrome, Hereditary Mixed, 2

Research Articles on BMPR1A

Similar Products

Product Notes

The BMPR1A bmpr1a (Catalog #AAA1266718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcagc tatacattta catcagatta ttgggagcct atttgttcat catttctcgt gttcaaggac agaatctgga tagtatgctt catggcactg ggatgaaatc agactccgac cagaaaaagt cagaaaatgg agtaacctta gcaccagagg ataccttgcc ttttttaaag tgctattgct cagggcactg tccagatgat gctattaata acacatgcat aactaatgga cattgctttg ccatcataga agaagatgac cagggagaaa ccacattagc ttcagggtgt atgaaatatg aaggatctga ttttcagtgc aaagattctc caaaagccca gctacgccgg acaatagaat gttgtcggac caatttatgt aaccagtatt tgcaacccac actgccccct gttgtcatag gtccgttttt tgatggcagc attcgatggc tggttttgct catttctatg gctgtctgca taattgctat gatcatcttc tccagctgct tttgttacaa acattattgc aagagcatct caagcagacg tcgttacaat cgtgatttgg aacaggatga agcatttatt ccagttggag aatcactaaa agaccttatt gaccagtcac aaagttctgg tagtgggtct ggactacctt tattggttca gcgaactatt gccaaacaga ttcagatggt ccggcaagtt ggtaaaggcc gatatggaga agtatggatg ggcaaatggc gtggcgaaaa agtggcggtg aaagtattct ttaccactga agaagccagc tggtttcgag aaacagaaat ctaccaaact gtgctaatgc gccatgaaaa catacttggt ttcatagcgg cagacattaa aggtacaggt tcctggactc agctctattt gattactgat taccatgaaa atggatctct ctatgacttc ctgaaatgtg ctacactgga caccagagcc ctgcttaaat tggcttattc agctgcctgt ggtctgtgcc acctgcacac agaaatttat ggcacccaag gaaagcccgc aattgctcat cgagacctaa agagcaaaaa catcctcatc aagaaaaatg ggagttgctg cattgctgac ctgggccttg ctgttaaatt caacagtgac acaaatgaag ttgatgtgcc cttgaatacc agggtgggca ccaaacgcta catggctccc gaagtgctgg acgaaagcct gaacaaaaac cacttccagc cctacatcat ggctgacatc tacagcttcg gcctaatcat ttgggagatg gctcgtcgtt gtatcacagg agggatcgtg gaagaatacc aattgccata ttacaacatg gtaccgagtg atccgtcata cgaagatatg cgtgaggttg tgtgtgtcaa acgtttgcgg ccaattgtgt ctaatcggtg gaacagtgat gaatgtctac gagcagtttt gaagctaatg tcagaatgct gggcccacaa tccagcctcc agactcacag cattgagaat taagaagacg cttgccaaga tggttgaatc ccaagatgta aaaatctga. It is sometimes possible for the material contained within the vial of "BMPR1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.