Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BMP15 cdna clone

BMP15 cDNA Clone

Gene Names
BMP15; ODG2; POF4; GDF9B
Synonyms
BMP15; BMP15 cDNA Clone; BMP15 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcctcctcagtattcttagaattctttttctttgtgaactcgtgcttttcatggaacacagggcccaaatggcagaaggagggcagtcctctattgcccttctggctgaggcccctactttgcccctgattgaggagctgctagaagaatcccctggcgaacagccaaggaagccccggctcctagggcattcactgcggtacatgctggagttgtaccggcgttcagctgactcgcatgggcaccctagagagaaccgcaccattggggccaccatggtgaggctggtgaagcccttgaccaatgtggcaaggcctcacagaggtacctggcatatacagatcctgggctttcctctcagaccaaaccgaggactataccaactagttagagccactgtggtttaccgccatcatctccaactaactcgcttcaatctctcctgccatgtggagccctgggtgcagaaaaacccaaccaaccacttcccttcctcagaaggagattcctcaaaaccttccctgatgtctaacgcttggaaagagatggatatcacacaacttgttcagcaaaggttctggaataacaagggacacaggatcctacgactccgttttatgtgtcagcagcaaaaagatagtggtggtcttgagctctggcatggcacttcatccttggacattgccttcttgttactctatttcaatgatactcataaaagcattcggaaggctaaatttcttcccaggggcatggaggagttcatggaaagggaatctcttctccggagaacccgacaagcagatggtatctcagctgaggttactgcctcttcctcaaaacatagcgggcctgaaaataaccagtgttccctccaccctttccaaatcagcttccgccagctgggttgggatcactggatcattgctccccctttctacaccccaaactactgtaaaggaacttgtctccgagtactacgcgatggtctcaattcccccaatcacgccattattcagaaccttatcaatcagttggtggaccagagtgtcccccggccctcctgtgtcccgtataagtatgttccaattagtgtccttatgattgaggcaaatgggagtattttgtacaaggagtatgagggtatgattgctgagtcttgtacatgcagatga
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,055 Da
NCBI Official Full Name
Homo sapiens bone morphogenetic protein 15, mRNA
NCBI Official Synonym Full Names
bone morphogenetic protein 15
NCBI Official Symbol
BMP15
NCBI Official Synonym Symbols
ODG2; POF4; GDF9B
NCBI Protein Information
bone morphogenetic protein 15
UniProt Protein Name
Bone morphogenetic protein 15
UniProt Gene Name
BMP15
UniProt Synonym Gene Names
GDF9B; BMP-15; GDF-9B
UniProt Entry Name
BMP15_HUMAN

NCBI Description

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate subunits of a disulfide-linked homodimer, or alternatively, a heterodimer, with the related protein, growth differentiation factor 9 (GDF9). This protein plays a role in oocyte maturation and follicular development, through activation of granulosa cells. Defects in this gene are the cause of ovarian dysgenesis and are associated with premature ovarian failure. [provided by RefSeq, Aug 2016]

Uniprot Description

BMP15: May be involved in follicular development. Oocyte- specific growth/differentiation factor that stimulates folliculogenesis and granulosa cell (GC) growth. Defects in BMP15 are the cause of ovarian dysgenesis type 2 (ODG2); also known as X-linked hypergonadotropic ovarian dysgenesis or hypergonadotropic ovarian failure due to ovarian dysgenesis. Ovarian dysgenesis leads to ovarian failure and accounts for about half of the cases of primary amenorrhea. Defects in BMP15 are the cause of premature ovarian failure type 4 (POF4). An ovarian disorder defined as the cessation of ovarian function under the age of 40 years. It is characterized by oligomenorrhea or amenorrhea, in the presence of elevated levels of serum gonadotropins and low estradiol. Belongs to the TGF-beta family.

Protein type: Secreted; Cytokine; Secreted, signal peptide

Chromosomal Location of Human Ortholog: Xp11.2

Cellular Component: extracellular space

Molecular Function: cytokine activity; transforming growth factor beta receptor binding

Biological Process: BMP signaling pathway; cell development; female gamete generation; regulation of apoptosis; regulation of MAPKKK cascade

Disease: Ovarian Dysgenesis 2

Research Articles on BMP15

Similar Products

Product Notes

The BMP15 bmp15 (Catalog #AAA1274737) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcctcc tcagtattct tagaattctt tttctttgtg aactcgtgct tttcatggaa cacagggccc aaatggcaga aggagggcag tcctctattg cccttctggc tgaggcccct actttgcccc tgattgagga gctgctagaa gaatcccctg gcgaacagcc aaggaagccc cggctcctag ggcattcact gcggtacatg ctggagttgt accggcgttc agctgactcg catgggcacc ctagagagaa ccgcaccatt ggggccacca tggtgaggct ggtgaagccc ttgaccaatg tggcaaggcc tcacagaggt acctggcata tacagatcct gggctttcct ctcagaccaa accgaggact ataccaacta gttagagcca ctgtggttta ccgccatcat ctccaactaa ctcgcttcaa tctctcctgc catgtggagc cctgggtgca gaaaaaccca accaaccact tcccttcctc agaaggagat tcctcaaaac cttccctgat gtctaacgct tggaaagaga tggatatcac acaacttgtt cagcaaaggt tctggaataa caagggacac aggatcctac gactccgttt tatgtgtcag cagcaaaaag atagtggtgg tcttgagctc tggcatggca cttcatcctt ggacattgcc ttcttgttac tctatttcaa tgatactcat aaaagcattc ggaaggctaa atttcttccc aggggcatgg aggagttcat ggaaagggaa tctcttctcc ggagaacccg acaagcagat ggtatctcag ctgaggttac tgcctcttcc tcaaaacata gcgggcctga aaataaccag tgttccctcc accctttcca aatcagcttc cgccagctgg gttgggatca ctggatcatt gctccccctt tctacacccc aaactactgt aaaggaactt gtctccgagt actacgcgat ggtctcaatt cccccaatca cgccattatt cagaacctta tcaatcagtt ggtggaccag agtgtccccc ggccctcctg tgtcccgtat aagtatgttc caattagtgt ccttatgatt gaggcaaatg ggagtatttt gtacaaggag tatgagggta tgattgctga gtcttgtaca tgcagatga. It is sometimes possible for the material contained within the vial of "BMP15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.