Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BLOC1S2 cdna clone

BLOC1S2 cDNA Clone

Gene Names
BLOC1S2; CEAP; BLOS2; BORCS2; CEAP11
Synonyms
BLOC1S2; BLOC1S2 cDNA Clone; BLOC1S2 cdna clone
Ordering
For Research Use Only!
Sequence
atgttctccaaaatggccacttacctgactggggaactgacggccaccagtgaagactataagctcctggaaaatatgaataaactcaccagcttgaagtatcttgaaatgaaagatattgctataaacattagtaggaacttaaaggacttaaaccagaaatatgctggactgcagccttatctggatcagatcaatgtcattgaagagcaggtagcagctcttgagcaggcagcttacaagttggatgcatattcaaaaaaactggaagccaagtacaagaagctggagaagcgatga
Sequence Length
300
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,489 Da
NCBI Official Full Name
Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2, mRNA
NCBI Official Synonym Full Names
biogenesis of lysosomal organelles complex 1 subunit 2
NCBI Official Symbol
BLOC1S2
NCBI Official Synonym Symbols
CEAP; BLOS2; BORCS2; CEAP11
NCBI Protein Information
biogenesis of lysosome-related organelles complex 1 subunit 2
UniProt Protein Name
Biogenesis of lysosome-related organelles complex 1 subunit 2
UniProt Gene Name
BLOC1S2
UniProt Synonym Gene Names
BLOS2; CEAP; BLOC-1 subunit 2
UniProt Entry Name
BL1S2_HUMAN

NCBI Description

This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

Uniprot Description

BLOC1S2: May play a role in cell proliferation. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. Plays a role in intracellular vesicle trafficking. Belongs to the BLOC1S2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation; Apoptosis; Mitochondrial

Chromosomal Location of Human Ortholog: 10q24.31

Cellular Component: gamma-tubulin complex; mitochondrion; protein complex

Molecular Function: gamma-tubulin binding; protein binding

Biological Process: anterograde axon cargo transport; anterograde synaptic vesicle transport; induction of apoptosis via death domain receptors; lysosome localization; neurite development

Research Articles on BLOC1S2

Similar Products

Product Notes

The BLOC1S2 bloc1s2 (Catalog #AAA1278062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttctcca aaatggccac ttacctgact ggggaactga cggccaccag tgaagactat aagctcctgg aaaatatgaa taaactcacc agcttgaagt atcttgaaat gaaagatatt gctataaaca ttagtaggaa cttaaaggac ttaaaccaga aatatgctgg actgcagcct tatctggatc agatcaatgt cattgaagag caggtagcag ctcttgagca ggcagcttac aagttggatg catattcaaa aaaactggaa gccaagtaca agaagctgga gaagcgatga. It is sometimes possible for the material contained within the vial of "BLOC1S2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.