Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BLOC1S1 cdna clone

BLOC1S1 cDNA Clone

Gene Names
BLOC1S1; RT14; BLOS1; MICoA; BORCS1; GCN5L1
Synonyms
BLOC1S1; BLOC1S1 cDNA Clone; BLOC1S1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtcccgcctcctaaaagaacaccaggccaagcagaatgaacgcaaggagctgcaggaaaagaggaggcgagaggctatcactgcagcgacctgcctgacagaagctttggtggatcacctcaatgtgggtgtggcccaggcctacatgaaccagagaaagctggaccatgaggtgaagaccctacaggtccaggctgcccaatttgccaagcagacaggccagtggatcggaatggtggagaacttcaaccaggcactcaaggaaattggggatgtggagaactgggctcggagcatcgagctggacatgcgcaccattgccactgcactggaatatgtctacaaagggcagctgcagtctgccccttcctag
Sequence Length
378
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,311 Da
NCBI Official Full Name
Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 1, mRNA
NCBI Official Synonym Full Names
biogenesis of lysosomal organelles complex 1 subunit 1
NCBI Official Symbol
BLOC1S1
NCBI Official Synonym Symbols
RT14; BLOS1; MICoA; BORCS1; GCN5L1
NCBI Protein Information
biogenesis of lysosome-related organelles complex 1 subunit 1
UniProt Protein Name
Biogenesis of lysosome-related organelles complex 1 subunit 1
UniProt Gene Name
BLOC1S1
UniProt Synonym Gene Names
BLOS1; GCN5L1; RT14; BLOC-1 subunit 1
UniProt Entry Name
BL1S1_HUMAN

NCBI Description

BLOC1S1 is a component of the ubiquitously expressed BLOC1 multisubunit protein complex. BLOC1 is required for normal biogenesis of specialized organelles of the endosomal-lysosomal system, such as melanosomes and platelet dense granules (Starcevic and Dell'Angelica, 2004 [PubMed 15102850]).[supplied by OMIM, Mar 2008]

Uniprot Description

BLOC1S1: May negatively regulate aerobic respiration through mitochondrial protein lysine-acetylation. May counteract the action of the deacetylase SIRT3 by acetylating and regulating proteins of the mitochondrial respiratory chain including ATP5A1 AND NDUFA9. May also be involved in the biogenesis of specialized organelles of the endosomal-lysosomal system. Belongs to the BLOC1S1 family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: Nuclear receptor co-regulator; Vesicle

Chromosomal Location of Human Ortholog: 12q13-q14

Cellular Component: cytosol; extracellular space; lysosomal membrane; mitochondrial intermembrane space; mitochondrial matrix; protein complex

Molecular Function: protein binding

Biological Process: aerobic respiration; anterograde axon cargo transport; anterograde synaptic vesicle transport; endosome transport; lysosome localization; neurite development; peptidyl-lysine acetylation

Research Articles on BLOC1S1

Similar Products

Product Notes

The BLOC1S1 bloc1s1 (Catalog #AAA1271871) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtccc gcctcctaaa agaacaccag gccaagcaga atgaacgcaa ggagctgcag gaaaagagga ggcgagaggc tatcactgca gcgacctgcc tgacagaagc tttggtggat cacctcaatg tgggtgtggc ccaggcctac atgaaccaga gaaagctgga ccatgaggtg aagaccctac aggtccaggc tgcccaattt gccaagcaga caggccagtg gatcggaatg gtggagaact tcaaccaggc actcaaggaa attggggatg tggagaactg ggctcggagc atcgagctgg acatgcgcac cattgccact gcactggaat atgtctacaa agggcagctg cagtctgccc cttcctag. It is sometimes possible for the material contained within the vial of "BLOC1S1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.