Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BLK cdna clone

BLK cDNA Clone

Gene Names
BLK; MODY11
Synonyms
BLK; BLK cDNA Clone; BLK cdna clone
Ordering
For Research Use Only!
Sequence
atggggctggtaagtagcaaaaagccggacaaggaaaagccgatcaaagagaaggacaagggccaatggagccccctgaaggtcagcgcccaagacaaggacgccccgccactgccgcccctggttgtcttcaaccaccttactcctccaccgcccgatgaacacctggatgaagacaagcatttcgtggtggctctgtatgactacaccgctatgaatgatcgggacctgcagatgctgaagggggagaagctacaggtcctgaagggaactggagactggtggctggccaggtcactcgtcacaggaagagaaggctatgtgcccagcaactttgtggcccgagtggagagcctggaaatggaaaggtggttctttagatcacagggtcggaaggaggctgagaggcagcttcttgctccaatcaacaaggccggctcctttcttatcagagagagtgaaaccaacaaaggtgccttctccctgtctgtgaaggatgtcaccacccagggggagctgatcaagcactataagatccgctgcctggatgaagggggctactacatctccccccggatcaccttcccctcgctccaggccctggtgcagcactattctaagaagggggatggtctatgccagaggctgaccctgccctgtgtgcgcccggccccgcagaatccctgggcccaggatgaatgggagatcccccggcagtctctcaggctggtcaggaaactcgggtctggacaattcggcgaagtctggatgggttactacaaaaacaacatgaaggtggccattaagacgctgaaggagggaaccatgtctccagaagcctttctgggtgaggccaacgtgatgaaggctctgcagcacgagcggctggtccgactctacgcagtggtcaccaaggagcccatctacattgtcaccgagtacatggccagaggatgcctgctggatttcctgaagacagatgaagggagcagattgtcactcccaaggctgattgacatgtcggcgcagattgctgaagggatggcatacattgagcgcatgaattccatccaccgcgacctgcgggcggccaacatcctggtgtctgaggccttgtgctgcaaaattgctgattttggcttggctcgaatcatcgacagtgaatacacggcccaagagggggccaagttccccatcaagtggacagccccggaagccatccacttcggggtcttcaccatcaaagcagacgtgtggtcgtttggagtcctcctgatggaagttgtcacttatgggcgggtgccatacccagggatgagcaaccccgaggtcatccgcaacctggagcgcggctaccgcatgccgcgccccgacacctgcccgcccgagctgtaccgcggcgtcatcgccgagtgctggcgcagccggcccgaggagcggcccaccttcgagttcctgcagtcggtgctggaggacttctacacggccaccgagcggcagtacgagctgcagccctag
Sequence Length
1518
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
640
Molecular Weight
57,706 Da
NCBI Official Full Name
Homo sapiens B lymphoid tyrosine kinase, mRNA
NCBI Official Synonym Full Names
BLK proto-oncogene, Src family tyrosine kinase
NCBI Official Symbol
BLK
NCBI Official Synonym Symbols
MODY11
NCBI Protein Information
tyrosine-protein kinase Blk
UniProt Protein Name
Tyrosine-protein kinase Blk
Protein Family
UniProt Gene Name
BLK
UniProt Entry Name
BLK_HUMAN

NCBI Description

This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]

Uniprot Description

BLK: a nonreceptor tyrosine kinase of the Src family. Expressed predominantly in B lymphocytes

Protein type: Kinase, protein; EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); Protein kinase, TK; TK group; Src family

Chromosomal Location of Human Ortholog: 8p23-p22

Cellular Component: extrinsic to internal side of plasma membrane

Molecular Function: non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding

Biological Process: B cell receptor signaling pathway; cell differentiation; cytoskeleton organization and biogenesis; innate immune response; negative regulation of apoptosis; positive regulation of insulin secretion; regulation of cell proliferation; regulation of phagocytosis; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Maturity-onset Diabetes Of The Young, Type 11

Research Articles on BLK

Similar Products

Product Notes

The BLK blk (Catalog #AAA1267188) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctgg taagtagcaa aaagccggac aaggaaaagc cgatcaaaga gaaggacaag ggccaatgga gccccctgaa ggtcagcgcc caagacaagg acgccccgcc actgccgccc ctggttgtct tcaaccacct tactcctcca ccgcccgatg aacacctgga tgaagacaag catttcgtgg tggctctgta tgactacacc gctatgaatg atcgggacct gcagatgctg aagggggaga agctacaggt cctgaaggga actggagact ggtggctggc caggtcactc gtcacaggaa gagaaggcta tgtgcccagc aactttgtgg cccgagtgga gagcctggaa atggaaaggt ggttctttag atcacagggt cggaaggagg ctgagaggca gcttcttgct ccaatcaaca aggccggctc ctttcttatc agagagagtg aaaccaacaa aggtgccttc tccctgtctg tgaaggatgt caccacccag ggggagctga tcaagcacta taagatccgc tgcctggatg aagggggcta ctacatctcc ccccggatca ccttcccctc gctccaggcc ctggtgcagc actattctaa gaagggggat ggtctatgcc agaggctgac cctgccctgt gtgcgcccgg ccccgcagaa tccctgggcc caggatgaat gggagatccc ccggcagtct ctcaggctgg tcaggaaact cgggtctgga caattcggcg aagtctggat gggttactac aaaaacaaca tgaaggtggc cattaagacg ctgaaggagg gaaccatgtc tccagaagcc tttctgggtg aggccaacgt gatgaaggct ctgcagcacg agcggctggt ccgactctac gcagtggtca ccaaggagcc catctacatt gtcaccgagt acatggccag aggatgcctg ctggatttcc tgaagacaga tgaagggagc agattgtcac tcccaaggct gattgacatg tcggcgcaga ttgctgaagg gatggcatac attgagcgca tgaattccat ccaccgcgac ctgcgggcgg ccaacatcct ggtgtctgag gccttgtgct gcaaaattgc tgattttggc ttggctcgaa tcatcgacag tgaatacacg gcccaagagg gggccaagtt ccccatcaag tggacagccc cggaagccat ccacttcggg gtcttcacca tcaaagcaga cgtgtggtcg tttggagtcc tcctgatgga agttgtcact tatgggcggg tgccataccc agggatgagc aaccccgagg tcatccgcaa cctggagcgc ggctaccgca tgccgcgccc cgacacctgc ccgcccgagc tgtaccgcgg cgtcatcgcc gagtgctggc gcagccggcc cgaggagcgg cccaccttcg agttcctgca gtcggtgctg gaggacttct acacggccac cgagcggcag tacgagctgc agccctag. It is sometimes possible for the material contained within the vial of "BLK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.