Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

BIRC8 cdna clone

BIRC8 cDNA Clone

Gene Names
BIRC8; ILP2; ILP-2; hILP2
Synonyms
BIRC8; BIRC8 cDNA Clone; BIRC8 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgacgggttatgaagcccggctcattacttttgggacatggatgtactccgttaacaaagagcagcttgcaagagctggattttatgctataggtcaagaggataaagtacagtgctttcactgtggaggagggctagccaactggaagcccaaggaagatccttgggaacagcatgctaaatggtatccaggttgcaaatatctgctagaagagaagggacatgaatatataaacaacattcatttaacccgttcacttgagggagctctggtacaaactaccaagaaaacaccatcactaactaaaagaatcagtgataccatcttccctaatcctatgctacaagaagctatacgaatgggatttgatttcaaggacgttaagaaaataatggaggaaagaattcaaacatctgggagcaactataaaacgcttggggttcttgttgcagatctagtgagcgctcagaaagacactacagaaaatgaattgaatcagacttcattgcagagagaaatcagccctgaagagccgctaaggcgtctgcaagaggagaagctttgtaaaatctgcatggacagacatatcgctgttgtttttattccttgtggacatctggtcacttgtaaacaatgtgctgaagcagttgacagatgtcccatgtgcagcatggttattgatttcaagcaaagagtttttatgtcttaa
Sequence Length
711
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,089 Da
NCBI Official Full Name
Homo sapiens baculoviral IAP repeat-containing 8, mRNA
NCBI Official Synonym Full Names
baculoviral IAP repeat containing 8
NCBI Official Symbol
BIRC8
NCBI Official Synonym Symbols
ILP2; ILP-2; hILP2
NCBI Protein Information
baculoviral IAP repeat-containing protein 8
UniProt Protein Name
Baculoviral IAP repeat-containing protein 8
Protein Family
UniProt Gene Name
BIRC8
UniProt Synonym Gene Names
ILP2; IAP-like protein 2; ILP-2
UniProt Entry Name
BIRC8_HUMAN

Uniprot Description

BIRC8: Protects against apoptosis mediated by BAX. Belongs to the IAP family.

Protein type: Ubiquitin conjugating system; Apoptosis

Chromosomal Location of Human Ortholog: -

Cellular Component: cytoplasm; nucleus; spindle microtubule

Molecular Function: caspase inhibitor activity; ubiquitin-protein ligase activity

Research Articles on BIRC8

1. Fumonisin B1 caused dose-dependent increase in BIRC-8/ILP-2 mRNA and protein expression in HepG2 cells to inhibit apoptosis.

Similar Products

BIRC8 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: ELISA, Western Blot

BIRC8 Recombinant Protein

Host: E Coli or Yeast or Baculovirus or Mammalian Cell
Reactivity: n/a
Apps: n/a

ILP2 Antibody

Host: n/a
Reactivity: n/a
Apps: n/a

BIRC8 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: Western Blot

BIRC8 Antibody

Host: Rabbit
Reactivity: Human, Mouse
Apps: ELISA, Western Blot

Product Notes

The BIRC8 birc8 (Catalog #AAA1269607) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgggtt atgaagcccg gctcattact tttgggacat ggatgtactc cgttaacaaa gagcagcttg caagagctgg attttatgct ataggtcaag aggataaagt acagtgcttt cactgtggag gagggctagc caactggaag cccaaggaag atccttggga acagcatgct aaatggtatc caggttgcaa atatctgcta gaagagaagg gacatgaata tataaacaac attcatttaa cccgttcact tgagggagct ctggtacaaa ctaccaagaa aacaccatca ctaactaaaa gaatcagtga taccatcttc cctaatccta tgctacaaga agctatacga atgggatttg atttcaagga cgttaagaaa ataatggagg aaagaattca aacatctggg agcaactata aaacgcttgg ggttcttgtt gcagatctag tgagcgctca gaaagacact acagaaaatg aattgaatca gacttcattg cagagagaaa tcagccctga agagccgcta aggcgtctgc aagaggagaa gctttgtaaa atctgcatgg acagacatat cgctgttgtt tttattcctt gtggacatct ggtcacttgt aaacaatgtg ctgaagcagt tgacagatgt cccatgtgca gcatggttat tgatttcaag caaagagttt ttatgtctta a. It is sometimes possible for the material contained within the vial of "BIRC8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

aaabiotech.com © 2012-2025

All rights reserved.

Contact us by

Tel: +1 (619) 604-9440 | Fax: +1 (619) 604-9440
contact@aaabiotech.com
Looking for a specific manual?
Request a Manual