BIRC8 cdna clone
BIRC8 cDNA Clone
Gene Names
BIRC8; ILP2; ILP-2; hILP2
Synonyms
BIRC8; BIRC8 cDNA Clone; BIRC8 cdna clone
Sequence
atgcatagtgaagaagctagattacagtcgtttcacaactggccagcctctgcccacttgaccccgagagagctggccagtgctgggctgtactacacaggcactgatgaccaagtgcagtgcttctgttgtggcggaaaactgaaaaactgggaacctggtgatcgtgcctggtcagaacacaggagacattttcctaattgcttctttattttgggccacaacgttaatattcgaggtgaatctgatgttgcgagttctgataggaatttctcaaattcaacaagttctccaaggaatccatccatgacgggttatgaagcccggctcattacttttgggacatggatgtactccgtcaacaaagagcagcttgcaagagctggattttatgctataggtcaagaggataaagtacagtgctttcactgtggaggagggctagccaactggaagcccaaggaagatccttgggaacagcatgctaaatggtatccaggttgcaaatatctgctagaagagaagggacatgaatatataaacaacattcatttaacccgttcacttgagggagctctggtacaaactaccaagaaaacaccatcactaactaaaagaatcagtgataccatcttccctaatcctatgctacaagaagctatacgaatgggatttgatttcaaggacgttaagaaaataatggaggaaagaattcaaacatctgggagcaactataaaacgcttgaggttcttgttgcagatctagtgagcgctcagaaagacactacagaaaatgaattgaatcagacttcattgcagagagaaatcagccctgaagagccgctaaggcgtctgcaagaggagaagctttgtaaaatctgcatggacagatatatcgctgttgtttttattccttgtggacatctggtcacttgtaaacaatgtgctgaagcagttgacagatgtcccatgtgcagcgcggttattgatttcaagcaaagagtttttatgtcttaa
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,089 Da
NCBI Official Full Name
Homo sapiens baculoviral IAP repeat-containing 8, mRNA
NCBI Official Synonym Full Names
baculoviral IAP repeat containing 8
NCBI Official Symbol
BIRC8
NCBI Official Synonym Symbols
ILP2; ILP-2; hILP2
NCBI Protein Information
baculoviral IAP repeat-containing protein 8
UniProt Protein Name
Baculoviral IAP repeat-containing protein 8
Protein Family
UniProt Gene Name
BIRC8
UniProt Synonym Gene Names
ILP2; IAP-like protein 2; ILP-2
UniProt Entry Name
BIRC8_HUMAN
Uniprot Description
BIRC8: Protects against apoptosis mediated by BAX. Belongs to the IAP family.
Protein type: Apoptosis; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: -
Cellular Component: cytoplasm; nucleus; spindle microtubule
Molecular Function: caspase inhibitor activity; ubiquitin-protein ligase activity
Research Articles on BIRC8
Similar Products
Product Notes
The BIRC8 birc8 (Catalog #AAA1267966) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatagtg aagaagctag attacagtcg tttcacaact ggccagcctc tgcccacttg accccgagag agctggccag tgctgggctg tactacacag gcactgatga ccaagtgcag tgcttctgtt gtggcggaaa actgaaaaac tgggaacctg gtgatcgtgc ctggtcagaa cacaggagac attttcctaa ttgcttcttt attttgggcc acaacgttaa tattcgaggt gaatctgatg ttgcgagttc tgataggaat ttctcaaatt caacaagttc tccaaggaat ccatccatga cgggttatga agcccggctc attacttttg ggacatggat gtactccgtc aacaaagagc agcttgcaag agctggattt tatgctatag gtcaagagga taaagtacag tgctttcact gtggaggagg gctagccaac tggaagccca aggaagatcc ttgggaacag catgctaaat ggtatccagg ttgcaaatat ctgctagaag agaagggaca tgaatatata aacaacattc atttaacccg ttcacttgag ggagctctgg tacaaactac caagaaaaca ccatcactaa ctaaaagaat cagtgatacc atcttcccta atcctatgct acaagaagct atacgaatgg gatttgattt caaggacgtt aagaaaataa tggaggaaag aattcaaaca tctgggagca actataaaac gcttgaggtt cttgttgcag atctagtgag cgctcagaaa gacactacag aaaatgaatt gaatcagact tcattgcaga gagaaatcag ccctgaagag ccgctaaggc gtctgcaaga ggagaagctt tgtaaaatct gcatggacag atatatcgct gttgttttta ttccttgtgg acatctggtc acttgtaaac aatgtgctga agcagttgac agatgtccca tgtgcagcgc ggttattgat ttcaagcaaa gagtttttat gtcttaa. It is sometimes possible for the material contained within the vial of "BIRC8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
