Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BIRC2 cdna clone

BIRC2 cDNA Clone

Gene Names
BIRC2; API1; MIHB; HIAP2; RNF48; cIAP1; Hiap-2; c-IAP1
Synonyms
BIRC2; BIRC2 cDNA Clone; BIRC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccggggtgcctgtctcagaaaggagtcttgctcgtgctggtttttattatactggtgtgaatgacaaggtcaaatgcttctgttgtggcctgatgctggataactggaaactaggagacagtcctattcaaaagcataaacagctatatcctagctgtagctttattcagaatctggtttcagctagtctgggatccacctctaagaatacgtctccaatgagaaacagttttgcacattcattatctcccaccttggaacatagtagcttgttcagtggttcttactccagcctttctccaaaccctcttaattctagagcagttgaagacatctcttcatcgaggactaacccctacagttatgcaatgagtactgaagaagccagatttcttacctaccatatgtggccattaacttttttgtcaccatcagaattggcaagagctggtttttattatataggacctggagatagggtagcctgctttgcctgtggtgggaagctcagtaactgggaaccaaaggatgatgctatgtcagaacaccggaggcattttcccaactgtccatttttggaaaattctctagaaactctgaggtttagcatttcaaatctgagcatgcagacacatgcagctcgaatgagaacatttatgtactggccatctagtgttccagttcagcctgagcagcttgcaagtgctggtttttattatgtgggtcgcaatgatgatgtcaaatgcttttgttgtgatggtggcttgaggtgttgggaatctggagatgatccatgggtagaacatgccaagtggtttccaaggtgtgagttcttgatacgaatgaaaggccaagagtttgttgatgagattcaaggtagatatcctcatcttcttgaacagctgttgtcaacttcagataccactggagaagaaaatgctgacccaccaattattcattttggacctggagaaagttcttcagaagatgctgtcatgatgaatacacctgtggttaaatctgccttggaaatgggctttaatagagacctggtgaaacaaacagttcaaagtaaaatcctgacaactggagagaactataaaacagttaatgatattgtgtcagcacttcttaatgctgaagatgaaaaaagagaagaggagaaggaaaaacaagctgaagaaatggcatcagatgatttgtcattaattcggaagaacagaatggctctctttcaacaattgacatgtgtgcttcctatcctggataatcttttaaaggccaatgtaattaataaacaggaacatgatattattaaacaaaaaacacagatacctttacaagcgagagaactgattgataccattttggttaaaggaaatgctgcggccaacatcttcaaaaactgtctaaaagaaattgactctacattgtataagaacttatttgtggataagaatatgaagtatattccaacagaagatgtttcaggtctgtcactggaagaacaattgaggaggttgcaagaagaacgaacttgtaaagtgtgtatggacaaagaagtttctgttgtatttattccttgtggtcatctggtagtatgccaggaatgtgccccttctctaagaaaatgccctatttgcaggggtataatcaagggtactgttcgtacatttctctcttaa
Sequence Length
1857
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
329
Molecular Weight
64,098 Da
NCBI Official Full Name
Homo sapiens baculoviral IAP repeat-containing 2, mRNA
NCBI Official Synonym Full Names
baculoviral IAP repeat containing 2
NCBI Official Symbol
BIRC2
NCBI Official Synonym Symbols
API1; MIHB; HIAP2; RNF48; cIAP1; Hiap-2; c-IAP1
NCBI Protein Information
baculoviral IAP repeat-containing protein 2
UniProt Protein Name
Baculoviral IAP repeat-containing protein 2
UniProt Gene Name
BIRC2
UniProt Synonym Gene Names
API1; MIHB; RNF48; hIAP-2; hIAP2
UniProt Entry Name
BIRC2_HUMAN

NCBI Description

The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

cIAP1: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin- protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin- protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO and MXD1/MAD1. Can also function as an E3 ubiquitin- protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Can stimulate the transcriptional activity of E2F1. Plays a role in the modulation of the cell cycle. Interacts with DIABLO/SMAC and with PRSS25; these interactions inhibit apoptotic suppressor activity. Interacts with CASP9. Interacts (via BIR domains) with TRAF2. Interacts with E2F1, RIPK1, RIPK2, RIPK3, RIPK4, BIRC5/survivin and USP19. Present in many fetal and adult tissues. Mainly expressed in adult skeletal muscle, thymus, testis, ovary, and pancreas, low or absent in brain and peripheral blood leukocytes. The CARD domain inhibits the activation of E3 ubiquitin ligase activity by preventing RING domain dimerization and E2 ubiquitin donor binding and activation. The CARD domain- mediated autoinhibition of the E3 ubiquitin-protein ligase activity suppresses cell proliferation and migration. USP19 regulates the stability of BIRC2/c-IAP1 by preventing its ubiquitination. Belongs to the IAP family.

Protein type: Ubiquitin conjugating system; Ligase; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 11q22

Cellular Component: cytoplasm; cytosol; internal side of plasma membrane; nucleus; spindle microtubule

Molecular Function: caspase inhibitor activity; protein binding; protein N-terminus binding; transcription coactivator activity; transferase activity; ubiquitin-protein ligase activity; zinc ion binding

Biological Process: cell structure disassembly during apoptosis; cell surface receptor linked signal transduction; I-kappaB kinase/NF-kappaB cascade; negative regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of apoptosis; regulation of cell cycle; regulation of cell differentiation; regulation of cell proliferation; regulation of inflammatory response; regulation of innate immune response; regulation of toll-like receptor signaling pathway; tumor necrosis factor-mediated signaling pathway

Research Articles on BIRC2

Similar Products

Product Notes

The BIRC2 birc2 (Catalog #AAA1265660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacaaaa ctgcctccca aagacttttc ccaggtccct cgtatcaaaa cattaagagt ataatggaag atagcacgat cttgtcagat tggacaaaca gcaacaaaca aaaaatgaag tatgactttt cctgtgaact ctacagaatg tctacatatt caactttccc cgccggggtg cctgtctcag aaaggagtct tgctcgtgct ggtttttatt atactggtgt gaatgacaag gtcaaatgct tctgttgtgg cctgatgctg gataactgga aactaggaga cagtcctatt caaaagcata aacagctata tcctagctgt agctttattc agaatctggt ttcagctagt ctgggatcca cctctaagaa tacgtctcca atgagaaaca gttttgcaca ttcattatct cccaccttgg aacatagtag cttgttcagt ggttcttact ccagcctttc tccaaaccct cttaattcta gagcagttga agacatctct tcatcgagga ctaaccccta cagttatgca atgagtactg aagaagccag atttcttacc taccatatgt ggccattaac ttttttgtca ccatcagaat tggcaagagc tggtttttat tatataggac ctggagatag ggtagcctgc tttgcctgtg gtgggaagct cagtaactgg gaaccaaagg atgatgctat gtcagaacac cggaggcatt ttcccaactg tccatttttg gaaaattctc tagaaactct gaggtttagc atttcaaatc tgagcatgca gacacatgca gctcgaatga gaacatttat gtactggcca tctagtgttc cagttcagcc tgagcagctt gcaagtgctg gtttttatta tgtgggtcgc aatgatgatg tcaaatgctt ttgttgtgat ggtggcttga ggtgttggga atctggagat gatccatggg tagaacatgc caagtggttt ccaaggtgtg agttcttgat acgaatgaaa ggccaagagt ttgttgatga gattcaaggt agatatcctc atcttcttga acagctgttg tcaacttcag ataccactgg agaagaaaat gctgacccac caattattca ttttggacct ggagaaagtt cttcagaaga tgctgtcatg atgaatacac ctgtggttaa atctgccttg gaaatgggct ttaatagaga cctggtgaaa caaacagttc aaagtaaaat cctgacaact ggagagaact ataaaacagt taatgatatt gtgtcagcac ttcttaatgc tgaagatgaa aaaagagaag aggagaagga aaaacaagct gaagaaatgg catcagatga tttgtcatta attcggaaga acagaatggc tctctttcaa caattgacat gtgtgcttcc tatcctggat aatcttttaa aggccaatgt aattaataaa caggaacatg atattattaa acaaaaaaca cagatacctt tacaagcgag agaactgatt gataccattt tggttaaagg aaatgctgcg gccaacatct tcaaaaactg tctaaaagaa attgactcta cattgtataa gaacttattt gtggataaga atatgaagta tattccaaca gaagatgttt caggtctgtc actggaagaa caattgagga ggttgcaaga agaacgaact tgtaaagtgt gtatggacaa agaagtttct gttgtattta ttccttgtgg tcatctggta gtatgccagg aatgtgcccc ttctctaaga aaatgcccta tttgcagggg tataatcaag ggtactgttc gtacatttct ctcttaa. It is sometimes possible for the material contained within the vial of "BIRC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.