Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BFAR cdna clone

BFAR cDNA Clone

Gene Names
BFAR; BAR; RNF47
Synonyms
BFAR; BFAR cDNA Clone; BFAR cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaacctcagaaaagctatgtgaacacaatggaccttgagagagatgaacctctcaaaagcaccggccctcagatttctgttagtgaattttcttgccactgctgctacgacatcctggttaaccccaccaccttgaactgtgggcacagcttctgccgtcactgccttgctttatggtgggcatcttcaaagaaaacagaatgtccagaatgcagagaaaaatgggaaggtttccccaaagtcagtattctcctcagggatgccattgaaaagttatttcctgatgccattagactgagatttgaagacattcagcagaataatgacatagtccaaagtcttgcagcctttcagaaatatgggaatgatcagattcctttagctcctaacacaggccgagcgaatcagcagatgggagggggattcttttccggtgtgctcacagctttaactggagtggcagtggtcctgctcgtctatcactggagcagcagggaatctgaacacgacctcctggtccacaaggctgtggccaaatggacggcggaagaagttgtcctctggctggagcagctgggcccttgggcatctctttacagggaaaggtttttatctgaacgagtaaatggaaggttgcttttaactttgacagaggaagaattttccaagacgccctataccatagaaaacagcagccacaggagagccatcctcatggagctagaacgtgtcaaagcattaggcgtgaagcccccccagaatctctgggaatataaggctgtgaacccaggcaggtccctgttcctgctatacgccctcaagagctcccccaggctgagtctgctctacctgtacctgtttgactacaccgacaccttcctacctttcatccacaccatctgccctctgcaagaagacagctctggggaggacatcgtcaccaagcttctggatcttaaggagcctacgtggaagcagtggagagagttcctggtcaaatactccttccttccataccagctgattgctgagtttgcttgggactggttggaggtccattactggacatcacggtttctcatcatcaatgctatgttactctcagttctggaattattctccttttggagaatctggtcgagaagtgaactgaagaccgtgcctcagaggatgtggagccatttctggaaagtatcaacgcaggggctttttgtggccatgttctggcccctcatccctcagtttgtttgcaactgtttgttttactgggccctgtactttaacccaattattaacattgatcttgtggtcaaggaactccggcggctggaaacccaggtgttgtga
Sequence Length
1353
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,652 Da
NCBI Official Full Name
Homo sapiens bifunctional apoptosis regulator, mRNA
NCBI Official Synonym Full Names
bifunctional apoptosis regulator
NCBI Official Symbol
BFAR
NCBI Official Synonym Symbols
BAR; RNF47
NCBI Protein Information
bifunctional apoptosis regulator
UniProt Protein Name
Bifunctional apoptosis regulator
UniProt Gene Name
BFAR
UniProt Synonym Gene Names
BAR; RNF47
UniProt Entry Name
BFAR_HUMAN

Uniprot Description

BFAR: Apoptosis regulator. Has anti-apoptotic activity, both for apoptosis triggered via death-receptors and via mitochondrial factors.

Protein type: Ubiquitin conjugating system; Membrane protein, multi-pass; Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 16p13.12

Cellular Component: endoplasmic reticulum; membrane

Molecular Function: protein binding; protein binding, bridging

Biological Process: negative regulation of apoptosis; proteasomal ubiquitin-dependent protein catabolic process; protein autoubiquitination; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on BFAR

Similar Products

Product Notes

The BFAR bfar (Catalog #AAA1272180) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaac ctcagaaaag ctatgtgaac acaatggacc ttgagagaga tgaacctctc aaaagcaccg gccctcagat ttctgttagt gaattttctt gccactgctg ctacgacatc ctggttaacc ccaccacctt gaactgtggg cacagcttct gccgtcactg ccttgcttta tggtgggcat cttcaaagaa aacagaatgt ccagaatgca gagaaaaatg ggaaggtttc cccaaagtca gtattctcct cagggatgcc attgaaaagt tatttcctga tgccattaga ctgagatttg aagacattca gcagaataat gacatagtcc aaagtcttgc agcctttcag aaatatggga atgatcagat tcctttagct cctaacacag gccgagcgaa tcagcagatg ggagggggat tcttttccgg tgtgctcaca gctttaactg gagtggcagt ggtcctgctc gtctatcact ggagcagcag ggaatctgaa cacgacctcc tggtccacaa ggctgtggcc aaatggacgg cggaagaagt tgtcctctgg ctggagcagc tgggcccttg ggcatctctt tacagggaaa ggtttttatc tgaacgagta aatggaaggt tgcttttaac tttgacagag gaagaatttt ccaagacgcc ctataccata gaaaacagca gccacaggag agccatcctc atggagctag aacgtgtcaa agcattaggc gtgaagcccc cccagaatct ctgggaatat aaggctgtga acccaggcag gtccctgttc ctgctatacg ccctcaagag ctcccccagg ctgagtctgc tctacctgta cctgtttgac tacaccgaca ccttcctacc tttcatccac accatctgcc ctctgcaaga agacagctct ggggaggaca tcgtcaccaa gcttctggat cttaaggagc ctacgtggaa gcagtggaga gagttcctgg tcaaatactc cttccttcca taccagctga ttgctgagtt tgcttgggac tggttggagg tccattactg gacatcacgg tttctcatca tcaatgctat gttactctca gttctggaat tattctcctt ttggagaatc tggtcgagaa gtgaactgaa gaccgtgcct cagaggatgt ggagccattt ctggaaagta tcaacgcagg ggctttttgt ggccatgttc tggcccctca tccctcagtt tgtttgcaac tgtttgtttt actgggccct gtactttaac ccaattatta acattgatct tgtggtcaag gaactccggc ggctggaaac ccaggtgttg tga. It is sometimes possible for the material contained within the vial of "BFAR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.