Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCAT2 cdna clone

BCAT2 cDNA Clone

Gene Names
BCAT2; BCAM; BCT2; PP18; BCATM
Synonyms
BCAT2; BCAT2 cDNA Clone; BCAT2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcagccgctctggggcagatctgggcacgaaagcttctctctgtcccttggcttctgtgtggtcccagaagatatgcctcctccagtttcaaggctgcagacctgcagctggaaatgacacagaagcctcataagaagcctggccccggcgagcccctggtgtttgggaagacatttaccgaccacatgctgatggtggaatggaatgacaagggctggggccagccccgaatccagcccttccagaacctcacgctgcacccagcctcctccagcctccactactccctgcagctgtttgagggcatgaaggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggctcaacatggaccggatgctgcgctcagccatgcgcctgtgcctgccgagtttcgacaagctggagttgctggagtgcatccgccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatgtgcggcctgtgctcattgggaacgagccctcgctgggtgtcagccagcccacgcgcgcgctcctgttcgtcattctctgcccagtgggtgcctacttccctggaggctccgtgaccccggtctccctcctggccgacccagccttcatccgggcctgggtgggcggggtcggcaactacaagttaggtgggaattatgggcccaccgtgttagtgcaacaggaggcactcaagcggggctgtgaacaggtcctctggctgtatgggcccgaccaccagctcaccgaggtgggaaccatgaacatctttgtctactggacccacgaagatggggtgctggagctggtgacgcccccgctgaatggtgttatcctgcctggagtggtcagacagagtctactggacatggctcagacctggggtgagttccgggtggtggagcgcacgatcaccatgaagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcaccgcttgccaggtctgcccagtgcaccgaatcctgtacaaagacaggaacctccacattcccaccatggaaaatgggcctgagctgatcctccgcttccagaaggagctgaaggagatccagtacggaatcagagcccacgagtggatgttcccggtgtga
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
587
Molecular Weight
33,777 Da
NCBI Official Full Name
Homo sapiens branched chain aminotransferase 2, mitochondrial, mRNA
NCBI Official Synonym Full Names
branched chain amino acid transaminase 2
NCBI Official Symbol
BCAT2
NCBI Official Synonym Symbols
BCAM; BCT2; PP18; BCATM
NCBI Protein Information
branched-chain-amino-acid aminotransferase, mitochondrial
UniProt Protein Name
Branched-chain-amino-acid aminotransferase, mitochondrial
UniProt Gene Name
BCAT2
UniProt Synonym Gene Names
BCATM; BCT2; ECA40; BCAT(m); PP18
UniProt Entry Name
BCAT2_HUMAN

NCBI Description

This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

BCAT2: Catalyzes the first reaction in the catabolism of the essential branched chain amino acids leucine, isoleucine, and valine. May also function as a transporter of branched chain alpha-keto acids. Belongs to the class-IV pyridoxal-phosphate-dependent aminotransferase family. Homodimer. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - valine, leucine and isoleucine biosynthesis; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Cofactor and Vitamin Metabolism - pantothenate and CoA biosynthesis; EC 2.6.1.42; Mitochondrial; Transferase

Chromosomal Location of Human Ortholog: 19q13

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: branched-chain-amino-acid transaminase activity; pyridoxal phosphate binding

Biological Process: aspartate biosynthetic process; branched chain family amino acid biosynthetic process; branched chain family amino acid catabolic process; leucine biosynthetic process; valine biosynthetic process

Research Articles on BCAT2

Similar Products

Product Notes

The BCAT2 bcat2 (Catalog #AAA1270578) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcag ccgctctggg gcagatctgg gcacgaaagc ttctctctgt cccttggctt ctgtgtggtc ccagaagata tgcctcctcc agtttcaagg ctgcagacct gcagctggaa atgacacaga agcctcataa gaagcctggc cccggcgagc ccctggtgtt tgggaagaca tttaccgacc acatgctgat ggtggaatgg aatgacaagg gctggggcca gccccgaatc cagcccttcc agaacctcac gctgcaccca gcctcctcca gcctccacta ctccctgcag ctgtttgagg gcatgaaggc gttcaaaggc aaagaccagc aggtgcgcct cttccgcccc tggctcaaca tggaccggat gctgcgctca gccatgcgcc tgtgcctgcc gagtttcgac aagctggagt tgctggagtg catccgccgg ctcatcgaag tggacaagga ctgggtcccc gatgccgccg gcaccagcct ctatgtgcgg cctgtgctca ttgggaacga gccctcgctg ggtgtcagcc agcccacgcg cgcgctcctg ttcgtcattc tctgcccagt gggtgcctac ttccctggag gctccgtgac cccggtctcc ctcctggccg acccagcctt catccgggcc tgggtgggcg gggtcggcaa ctacaagtta ggtgggaatt atgggcccac cgtgttagtg caacaggagg cactcaagcg gggctgtgaa caggtcctct ggctgtatgg gcccgaccac cagctcaccg aggtgggaac catgaacatc tttgtctact ggacccacga agatggggtg ctggagctgg tgacgccccc gctgaatggt gttatcctgc ctggagtggt cagacagagt ctactggaca tggctcagac ctggggtgag ttccgggtgg tggagcgcac gatcaccatg aagcagttgc tgcgggccct ggaggagggc cgcgtgcggg aagtctttgg ctcgggcacc gcttgccagg tctgcccagt gcaccgaatc ctgtacaaag acaggaacct ccacattccc accatggaaa atgggcctga gctgatcctc cgcttccaga aggagctgaa ggagatccag tacggaatca gagcccacga gtggatgttc ccggtgtga. It is sometimes possible for the material contained within the vial of "BCAT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.