Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCAN cdna clone

BCAN cDNA Clone

Gene Names
BCAN; BEHAB; CSPG7
Synonyms
BCAN; BCAN cDNA Clone; BCAN cdna clone
Ordering
For Research Use Only!
Sequence
atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacgtccactacctgcggccaccgccgagccgccgggctgtgctgggctctccgcgggtcaagtggactttcctgtcccggggccgggaggcagaggtgctggtggcgcggggagtgcgcgtcaaggtgaacgaggcctaccggttccgcgtggcactgcctgcgtacccagcgtcgctcaccgacgtctccctggcgctgagcgagctgcgccccaacgactcgggtatctatcgctgtgaggtccagcacggcatcgatgacagcagcgacgctgtggaggtcaaggtcaaaggggtcgtctttctctaccgagagggctctgcccgctatgctttctccttttctggggcccaggaggcctgtgcccgcattggagcccacatcgccaccccggagcagctctatgccgcctaccttgggggctatgagcaatgtgatgctggctggctgtcggatcagaccgtgaggtatcccatccagaccccacgagaggcctgttacggagacatggatggcttccccggggtccggaactatggtgtggtggacccggatgacctctatgatgtgtactgttatgctgaagacctaaatggagaactgttcctgggtgaccctccagagaagctgacattggaggaagcacgggcgtactgccaggagcggggtgcagagattgccaccacgggccaactgtatgcagcctgggatggtggcctggaccactgcagcccagggtggctagctgatggcagtgtgcgctaccccatcgtcacacccagccagcgctgtggtgggggcttgcctggtgtcaagactctcttcctcttccccaaccagactggcttccccaataagcacagccgcttcaacgtctactgcttccgagactcggcccagccttctgccatccctgaggcctccaacccagcctccaacccagcctctgatggactagaggctatcgtcacagtgacagagaccctggaggaactgcagctgcctcaggaagccacagagagtgaatcccgtggggccatctactccatccccatcatggaggacggaggaggtggaagctccactccagaagacccagcagaggcccctaggacgctcctagaatttgaaacacaatccatggtaccgcccacggggttctcagaagaggaaggtaaggcattggaggaagaagagaaatatgaagatgaagaagagaaagaggaggaagaagaagaggaggaggtggaggatgaggctctgtgggcatggcccagcgagctcagcagcccgggccctgaggcctctctccccactgagccagcagcccaggagaagtcactctcccaggcgccagcaagggcagtcctgcagcctggtgcatcaccacttcctgatggagagtcagaagcttccaggcctccaagggtccatggaccacctactgagactctgcccactcccagggagaggaacctagcatccccatcaccttccactctggttgaggcaagagaggtgggggaggcaactggtggtcctgagctatctggggtccctcgaggagagagcgaggagacaggaagctccgagggtgccccttccctgcttccagccacacgggcccctgagggtaccagggagctggaggccccctctgaagataattctggaagaactgccccagcagggacctcagtgcaggcccagccagtgctgcccactgacagcgccagccgaggtggagtggccgtggtccccgcatcaggtgactgtgtccccagcccctgccacaatggtgggacatgcttggaggaggaggaaggggtccgctgcctatgtctgcctggctatgggggggacctgtgcgatgttggcctccgcttctgcaaccccggctgggacgccttccagggcgcctgctacaagcacttttccacacgaaggagctgggaggaggcagagacccagtgccggatgtacggcgcgcatctggccagcatcagcacacccgaggaacaggacttcatcaacaaccggtaccgggagtaccagtggatcggactcaacgacaggaccatcgaaggcgacttcttgtggtcggatggcgtccccctgctctatgagaactggaaccctgggcagcctgacagctacttcctgtctggagagaactgcgtggtcatggtgtggcatgatcagggacaatggagtgacgtgccctgcaactaccacctgtcctacacctgcaagatggggctggtgtcctgtgggccgccaccggagctgcccctggctcaagtgttcggccgcccacggctgcgctatgaggtggacactgtgcttcgctaccggtgccgggaaggactggcccagcgcaatctgccgctgatccgatgccaagagaacggtcgttgggaggccccccagatctcctgtgtgcccagaagacctgcccgagctctgcacccagaggaggacccagaaggacgtcaggggaggctactgggacgctggaaggcgctgttgatccccccttccagccccatgccaggtccctag
Sequence Length
2736
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,671 Da
NCBI Official Full Name
Homo sapiens brevican, mRNA
NCBI Official Synonym Full Names
brevican
NCBI Official Symbol
BCAN
NCBI Official Synonym Symbols
BEHAB; CSPG7
NCBI Protein Information
brevican core protein
UniProt Protein Name
Brevican core protein
Protein Family
UniProt Gene Name
BCAN
UniProt Synonym Gene Names
BEHAB; CSPG7; BEHAB
UniProt Entry Name
PGCB_HUMAN

NCBI Description

This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Uniprot Description

BCAN: May play a role in the terminally differentiating and the adult nervous system during postnatal development. Could stabilize interactions between hyaluronan (HA) and brain proteoglycans. Belongs to the aggrecan/versican proteoglycan family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Membrane protein, GPI anchor; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q31

Cellular Component: extracellular region; Golgi lumen; lysosomal lumen; proteinaceous extracellular matrix

Molecular Function: extracellular matrix structural constituent; hyaluronic acid binding

Biological Process: cell adhesion; central nervous system development; chondroitin sulfate biosynthetic process; chondroitin sulfate catabolic process; dermatan sulfate biosynthetic process; extracellular matrix disassembly; extracellular matrix organization and biogenesis; glycosaminoglycan metabolic process; skeletal development

Research Articles on BCAN

Similar Products

Product Notes

The BCAN bcan (Catalog #AAA1268629) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagc tgttcctgcc cctgctggca gccctggtcc tggcccaggc tcctgcagct ttagcagatg ttctggaagg agacagctca gaggaccgcg cttttcgcgt gcgcatcgcg ggcgacgcgc cactgcaggg cgtgctcggc ggcgccctca ccatcccttg ccacgtccac tacctgcggc caccgccgag ccgccgggct gtgctgggct ctccgcgggt caagtggact ttcctgtccc ggggccggga ggcagaggtg ctggtggcgc ggggagtgcg cgtcaaggtg aacgaggcct accggttccg cgtggcactg cctgcgtacc cagcgtcgct caccgacgtc tccctggcgc tgagcgagct gcgccccaac gactcgggta tctatcgctg tgaggtccag cacggcatcg atgacagcag cgacgctgtg gaggtcaagg tcaaaggggt cgtctttctc taccgagagg gctctgcccg ctatgctttc tccttttctg gggcccagga ggcctgtgcc cgcattggag cccacatcgc caccccggag cagctctatg ccgcctacct tgggggctat gagcaatgtg atgctggctg gctgtcggat cagaccgtga ggtatcccat ccagacccca cgagaggcct gttacggaga catggatggc ttccccgggg tccggaacta tggtgtggtg gacccggatg acctctatga tgtgtactgt tatgctgaag acctaaatgg agaactgttc ctgggtgacc ctccagagaa gctgacattg gaggaagcac gggcgtactg ccaggagcgg ggtgcagaga ttgccaccac gggccaactg tatgcagcct gggatggtgg cctggaccac tgcagcccag ggtggctagc tgatggcagt gtgcgctacc ccatcgtcac acccagccag cgctgtggtg ggggcttgcc tggtgtcaag actctcttcc tcttccccaa ccagactggc ttccccaata agcacagccg cttcaacgtc tactgcttcc gagactcggc ccagccttct gccatccctg aggcctccaa cccagcctcc aacccagcct ctgatggact agaggctatc gtcacagtga cagagaccct ggaggaactg cagctgcctc aggaagccac agagagtgaa tcccgtgggg ccatctactc catccccatc atggaggacg gaggaggtgg aagctccact ccagaagacc cagcagaggc ccctaggacg ctcctagaat ttgaaacaca atccatggta ccgcccacgg ggttctcaga agaggaaggt aaggcattgg aggaagaaga gaaatatgaa gatgaagaag agaaagagga ggaagaagaa gaggaggagg tggaggatga ggctctgtgg gcatggccca gcgagctcag cagcccgggc cctgaggcct ctctccccac tgagccagca gcccaggaga agtcactctc ccaggcgcca gcaagggcag tcctgcagcc tggtgcatca ccacttcctg atggagagtc agaagcttcc aggcctccaa gggtccatgg accacctact gagactctgc ccactcccag ggagaggaac ctagcatccc catcaccttc cactctggtt gaggcaagag aggtggggga ggcaactggt ggtcctgagc tatctggggt ccctcgagga gagagcgagg agacaggaag ctccgagggt gccccttccc tgcttccagc cacacgggcc cctgagggta ccagggagct ggaggccccc tctgaagata attctggaag aactgcccca gcagggacct cagtgcaggc ccagccagtg ctgcccactg acagcgccag ccgaggtgga gtggccgtgg tccccgcatc aggtgactgt gtccccagcc cctgccacaa tggtgggaca tgcttggagg aggaggaagg ggtccgctgc ctatgtctgc ctggctatgg gggggacctg tgcgatgttg gcctccgctt ctgcaacccc ggctgggacg ccttccaggg cgcctgctac aagcactttt ccacacgaag gagctgggag gaggcagaga cccagtgccg gatgtacggc gcgcatctgg ccagcatcag cacacccgag gaacaggact tcatcaacaa ccggtaccgg gagtaccagt ggatcggact caacgacagg accatcgaag gcgacttctt gtggtcggat ggcgtccccc tgctctatga gaactggaac cctgggcagc ctgacagcta cttcctgtct ggagagaact gcgtggtcat ggtgtggcat gatcagggac aatggagtga cgtgccctgc aactaccacc tgtcctacac ctgcaagatg gggctggtgt cctgtgggcc gccaccggag ctgcccctgg ctcaagtgtt cggccgccca cggctgcgct atgaggtgga cactgtgctt cgctaccggt gccgggaagg actggcccag cgcaatctgc cgctgatccg atgccaagag aacggtcgtt gggaggcccc ccagatctcc tgtgtgccca gaagacctgc ccgagctctg cacccagagg aggacccaga aggacgtcag gggaggctac tgggacgctg gaaggcgctg ttgatccccc cttccagccc catgccaggt ccctag. It is sometimes possible for the material contained within the vial of "BCAN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.