BAIAP3 cdna clone
BAIAP3 cDNA Clone
Gene Names
BAIAP3; BAP3
Synonyms
BAIAP3; BAIAP3 cDNA Clone; BAIAP3 cdna clone
Sequence
atgagaccccggggagcagcgtttgcagcgggcccgccaggtgacctgcacctgggcaccgccatcggcttcgcaggggccatctggaggagtcggtcacccgccatgtcgaccttgctggacattaagagcagcgtgctcaggcaggtgcaggtgtgcccgtccttccgccgcaggactgagcaggacccagggagtgccagcgccgacccgcaggagcctgccacgggggcctggaaacccggggatggcgtggagttctttgcccacatgcgcctcatgctgaagaagggggaaggcagacagggcttgccgtgcctcgaggtccccctgcgcagtggctcgccagcacccccggagcctgtggatcccagcctcggcctgagagccctggccccagaggaggtggagatgctctacgaggaggccctgtacacggtgctttaccgcgcgggtaccatgggccctgaccaggtggacgacgaggaggccctgctcagctatctccagcaggtgtttggcaccagccttgaggagcacactgaggccatcgagcgagtgaggaaggccaaggcccccacgtatgccctgaaagtctctgtcatgcgtgccaagaaccttctggccaaggaccccaacggcttcagcgacccatactgcatgctgggcatcctgcctgcctcggacgccacgcgggagccccgtgcacagaaggagcagcgcttcggcttccgcaagggcagcaagcgcggtggacccctgcctgccaagtgcatccaggtcaccgaggtgaagagcagcaccctgaaccccgtctggaaggagcacttcctcttcgagattgaggatgtgagcacggaccagctgcacctggacatctgggatcatgacgacgatgtatccctggtagaagcgtgcaggaagctgaatgaagtcatcggcctgaagggcatgggcaggtacttcaaacagatcgtcaagtcagcccgcgcaaacgggacagcaggacccaccgaggaccacaccgatgacttcctggggtgcctcaacatacctgtccgggaggtgcctgtggctggcgtcgaccgctggttcaagctggagccacgctccagtgcctcgcgtgtgcagggacactgccacctggttctcaagctgatcactacgcagagggatacggccatgagccagcgcgggcgatccggcttcctgtcccacctgctgctgctcagccatctgctgcggttggagcactcagcagaggagcccaactccagcagctggcgaggagagctcagcacaccagccgccaccatcctctgcctgcacggagcccagagcaacctgtcacccttgcagctggccgtgctgcactggcaggtcagcagccgccaccatcaaacctgcacgctggactacagctacctgctggggctgctggaggacatgcaggcacactgggaagaggctccttcactgccccaggagcaggaggagagcctggctgatagcctttccgccttctctgagttcgggctgcagctgctgcgccagctccgagactacttccctgccaccaacagcaccgctgtccaccgcctggagctgctgctgaagtgtctgggcaagctgcagctcttccaaccctcctttgagatctgccccttcgagtcggagctgaacatggacattgctgcggccctgaagagaggcaaccgtgagtggtacgacaggatcctgaatgccaagagtccccgagagcagccaggaccacagcgcctgcctgggctggttgtgctggctgacgccgtctatgatgaccttcagttctgctacagtgtgtacgccagcctcttccacagcatcctcaatgtggacgtcttcaccctgaccttccggcagctggagcgtctggtggctgaggaggcgtgggtgctgacggaggagctgagccccaagatgaccctggaggtggcctcggggctctttgagctctacctgaccctggctgacctccagcgcttctgggatagcatccctggccgggacagccgctctctggccctggctggcatccacgcccccttcctgcctgctgtgaagctctggttccaagtgctgagggaccaggccaagtggaggcttcagggagccgtggacatggacacgctggagcccgtggacgcctcctccaggcacagcagctccgcagccactgctggtctctgcctcagccacatccaggagttgtgggtgcgcctggcgtggcctgaccctgcccaggctcaggggctgggcacccagcttggccaggacgtgtgtgaggccaccctcttctatacggagctgcttcggaagaaggtggacactcagccaggggcggccggtgaagcagtgagcgaggcgctctgcgtggtcctcaacaatgtggagctcgtgcgcaaggctgctgggcaggccttgaagggcctggcatggccagagggggccacggggcccgagggggtgctcccccgccctctgctcagctgcacacaggccctggacgatgatctgcaacgggaggcccacacggtgacagcgcacctgacctctaagatggtgggcgacatccgcaagtatgtacagcacatcagtctctcgcctgactccatccagaacgatgaggccgtggccccgctcatgaagtacctggatgagaagctggccctgctgaacgcctcgctggtgaaggggaacctgagcagggtgctggaggccctgtgggagctactcctccaggccattctgcaggcgctgggtgcaaaccgtgacgtctctgctgatttctacagccgcttccatttcacgctggaggccctggtcagttttttccacgcagagggtcagggtttgcccctggagagcctgagggatggaagctacaagaggctgaaggaggagctgcggctgcacaaatgttccacccgcgagtgcatcgagcagttctacctggacaagctcaaacagaggaccctggagcagaaccggtttggacgcctgagcgtccgttgccattacgaggcggctgagcagcggctggccgtggaggtgctgcacgccgcggacctgctccccctggatgccaacggcttaagtgacccctttgtgatcgtggagctgggcccaccgcatctctttccactggtccgcagccagaggacccaggtgaagacccggacgctgcaccctgtatacgacgaactcttctacttttccgtgcctgccgaggcgtgccgccgccgcgcggcctgtgtgttgttcaccgtcatggaccacgactggctgtccaccaacgacttcgctggggaggcggccctcggcctaggtggcgtcactggtgtcgcccggccccaggtgggcgggggtgcaagggctgggcagcctgtcaccctgcacctgtgccggcccagagcccaggtgagatctgcgctgaggaggctggaaggccgcaccagcaaggaggcgcaggagttcgtgaagaaactcaaggagctggagaagtgcatggaggcggacccctga
Sequence Length
3564
Vector
pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
124,344 Da
NCBI Official Full Name
Homo sapiens BAI1-associated protein 3, mRNA
NCBI Official Synonym Full Names
BAI1 associated protein 3
NCBI Official Symbol
BAIAP3
NCBI Official Synonym Symbols
BAP3
NCBI Protein Information
BAI1-associated protein 3
UniProt Protein Name
BAI1-associated protein 3
Protein Family
UniProt Gene Name
BAIAP3
UniProt Synonym Gene Names
KIAA0734; BAP3
UniProt Entry Name
BAIP3_HUMAN
NCBI Description
This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Uniprot Description
BAIAP3: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 16p13.3
Molecular Function: protein C-terminus binding
Biological Process: G-protein coupled receptor protein signaling pathway; neurotransmitter secretion
Research Articles on BAIAP3
Similar Products
Product Notes
The BAIAP3 baiap3 (Catalog #AAA1266407) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagacccc ggggagcagc gtttgcagcg ggcccgccag gtgacctgca cctgggcacc gccatcggct tcgcaggggc catctggagg agtcggtcac ccgccatgtc gaccttgctg gacattaaga gcagcgtgct caggcaggtg caggtgtgcc cgtccttccg ccgcaggact gagcaggacc cagggagtgc cagcgccgac ccgcaggagc ctgccacggg ggcctggaaa cccggggatg gcgtggagtt ctttgcccac atgcgcctca tgctgaagaa gggggaaggc agacagggct tgccgtgcct cgaggtcccc ctgcgcagtg gctcgccagc acccccggag cctgtggatc ccagcctcgg cctgagagcc ctggccccag aggaggtgga gatgctctac gaggaggccc tgtacacggt gctttaccgc gcgggtacca tgggccctga ccaggtggac gacgaggagg ccctgctcag ctatctccag caggtgtttg gcaccagcct tgaggagcac actgaggcca tcgagcgagt gaggaaggcc aaggccccca cgtatgccct gaaagtctct gtcatgcgtg ccaagaacct tctggccaag gaccccaacg gcttcagcga cccatactgc atgctgggca tcctgcctgc ctcggacgcc acgcgggagc cccgtgcaca gaaggagcag cgcttcggct tccgcaaggg cagcaagcgc ggtggacccc tgcctgccaa gtgcatccag gtcaccgagg tgaagagcag caccctgaac cccgtctgga aggagcactt cctcttcgag attgaggatg tgagcacgga ccagctgcac ctggacatct gggatcatga cgacgatgta tccctggtag aagcgtgcag gaagctgaat gaagtcatcg gcctgaaggg catgggcagg tacttcaaac agatcgtcaa gtcagcccgc gcaaacggga cagcaggacc caccgaggac cacaccgatg acttcctggg gtgcctcaac atacctgtcc gggaggtgcc tgtggctggc gtcgaccgct ggttcaagct ggagccacgc tccagtgcct cgcgtgtgca gggacactgc cacctggttc tcaagctgat cactacgcag agggatacgg ccatgagcca gcgcgggcga tccggcttcc tgtcccacct gctgctgctc agccatctgc tgcggttgga gcactcagca gaggagccca actccagcag ctggcgagga gagctcagca caccagccgc caccatcctc tgcctgcacg gagcccagag caacctgtca cccttgcagc tggccgtgct gcactggcag gtcagcagcc gccaccatca aacctgcacg ctggactaca gctacctgct ggggctgctg gaggacatgc aggcacactg ggaagaggct ccttcactgc cccaggagca ggaggagagc ctggctgata gcctttccgc cttctctgag ttcgggctgc agctgctgcg ccagctccga gactacttcc ctgccaccaa cagcaccgct gtccaccgcc tggagctgct gctgaagtgt ctgggcaagc tgcagctctt ccaaccctcc tttgagatct gccccttcga gtcggagctg aacatggaca ttgctgcggc cctgaagaga ggcaaccgtg agtggtacga caggatcctg aatgccaaga gtccccgaga gcagccagga ccacagcgcc tgcctgggct ggttgtgctg gctgacgccg tctatgatga ccttcagttc tgctacagtg tgtacgccag cctcttccac agcatcctca atgtggacgt cttcaccctg accttccggc agctggagcg tctggtggct gaggaggcgt gggtgctgac ggaggagctg agccccaaga tgaccctgga ggtggcctcg gggctctttg agctctacct gaccctggct gacctccagc gcttctggga tagcatccct ggccgggaca gccgctctct ggccctggct ggcatccacg cccccttcct gcctgctgtg aagctctggt tccaagtgct gagggaccag gccaagtgga ggcttcaggg agccgtggac atggacacgc tggagcccgt ggacgcctcc tccaggcaca gcagctccgc agccactgct ggtctctgcc tcagccacat ccaggagttg tgggtgcgcc tggcgtggcc tgaccctgcc caggctcagg ggctgggcac ccagcttggc caggacgtgt gtgaggccac cctcttctat acggagctgc ttcggaagaa ggtggacact cagccagggg cggccggtga agcagtgagc gaggcgctct gcgtggtcct caacaatgtg gagctcgtgc gcaaggctgc tgggcaggcc ttgaagggcc tggcatggcc agagggggcc acggggcccg agggggtgct cccccgccct ctgctcagct gcacacaggc cctggacgat gatctgcaac gggaggccca cacggtgaca gcgcacctga cctctaagat ggtgggcgac atccgcaagt atgtacagca catcagtctc tcgcctgact ccatccagaa cgatgaggcc gtggccccgc tcatgaagta cctggatgag aagctggccc tgctgaacgc ctcgctggtg aaggggaacc tgagcagggt gctggaggcc ctgtgggagc tactcctcca ggccattctg caggcgctgg gtgcaaaccg tgacgtctct gctgatttct acagccgctt ccatttcacg ctggaggccc tggtcagttt tttccacgca gagggtcagg gtttgcccct ggagagcctg agggatggaa gctacaagag gctgaaggag gagctgcggc tgcacaaatg ttccacccgc gagtgcatcg agcagttcta cctggacaag ctcaaacaga ggaccctgga gcagaaccgg tttggacgcc tgagcgtccg ttgccattac gaggcggctg agcagcggct ggccgtggag gtgctgcacg ccgcggacct gctccccctg gatgccaacg gcttaagtga cccctttgtg atcgtggagc tgggcccacc gcatctcttt ccactggtcc gcagccagag gacccaggtg aagacccgga cgctgcaccc tgtatacgac gaactcttct acttttccgt gcctgccgag gcgtgccgcc gccgcgcggc ctgtgtgttg ttcaccgtca tggaccacga ctggctgtcc accaacgact tcgctgggga ggcggccctc ggcctaggtg gcgtcactgg tgtcgcccgg ccccaggtgg gcgggggtgc aagggctggg cagcctgtca ccctgcacct gtgccggccc agagcccagg tgagatctgc gctgaggagg ctggaaggcc gcaccagcaa ggaggcgcag gagttcgtga agaaactcaa ggagctggag aagtgcatgg aggcggaccc ctga. It is sometimes possible for the material contained within the vial of "BAIAP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
