Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAIAP2 cdna clone

BAIAP2 cDNA Clone

Gene Names
BAIAP2; BAP2; FLAF3; IRSP53
Synonyms
BAIAP2; BAIAP2 cDNA Clone; BAIAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctctgtctcgctcagaggagatgcaccggctcacggaaaatgtctataagaccatcatggagcagttcaaccctagcctccggaacttcatcgccatggggaagaattacgagaaggcactggcaggtgtgacgtatgcagccaaaggctactttgacgccctggtgaagatgggggagctggccagcgagagccagggctccaaagaactcggagacgttctcttccagatggctgaagtccacaggcagatccagaatcagctggaagaaatgctgaagtcttttcacaacgagctgcttacgcagctggagcagaaggtggagctggactccaggtatctgagtgctgcgctgaagaaataccagactgagcaaaggagcaaaggcgacgccctggacaagtgtcaggctgagctgaagaagcttcggaagaagagccagggcagcaagaatcctcagaagtactcggacaaggagctgcagtacatcgacgccatcagcaacaagcagggcgagctggagaattacgtgtccgacggctacaagaccgcactgacagaggagcgcaggcgcttctgcttcctggtggagaagcagtgcgccgtggccaagaactccgcggcctaccactccaagggcaaggagctgctggcgcagaagctgccgctgtggcaacaggcctgtgccgaccccagcaagatcccggagcgcgcggtgcagctcatgcagcaggtggccagcaacggcgccaccctccccagcgccctgtcggcctccaagtccaacctggtcatttccgaccccattccgggggccaagcccctgccggtgccccccgagctggcaccgttcgtggggcggatgtctgcccaggagagcacacccatcatgaacggcgtcacaggcccggatggcgaggactacagcccgtgggctgaccgcaaggctgcccagcccaaatccctgtctcctccgcagtctcagagcaagctcagcgactcctactccaacacactccccgtgcgcaagagcgtgaccccaaaaaacagctatgccaccaccgagaacaagactctgcctcgctcgagctccatggcagccggcctggagcgcaatggccgtatgcgggtgaaggccatcttctcccacgctgctggggacaacagcaccctcctgagcttcaaggagggtgacctcattaccctgctggtgcctgaggcccgcgatggctggcactacggagagagtgagaagaccaagatgcggggctggtttcccttctcctacacccgggtcttggacagcgatggcagtgacaggctgcacatgagcctgcagcaagggaagagcagcagcacgggcaacctcctggacaaggacgacctggccatcccaccccccgattacggcgccgcctcccgggccttccccgcccagacggccagcggcttcaagcagaggccctacagtgtggccgtgcccgccttctcccagggcctggatgactatggagcgcggtccatgagcaggtaa
Sequence Length
1539
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,430 Da
NCBI Official Full Name
Homo sapiens BAI1-associated protein 2, mRNA
NCBI Official Synonym Full Names
BAI1 associated protein 2
NCBI Official Symbol
BAIAP2
NCBI Official Synonym Symbols
BAP2; FLAF3; IRSP53
NCBI Protein Information
brain-specific angiogenesis inhibitor 1-associated protein 2
UniProt Protein Name
Brain-specific angiogenesis inhibitor 1-associated protein 2
UniProt Gene Name
BAIAP2
UniProt Synonym Gene Names
BAI-associated protein 2; BAI1-associated protein 2; Protein BAP2; FLAF3; IRS-58; IRSp53/58; IRSp53; Insulin receptor substrate p53
UniProt Entry Name
BAIP2_HUMAN

NCBI Description

The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]

Uniprot Description

IRSp53: Adapter protein that links membrane-bound small G- proteins to cytoplasmic effector proteins. Necessary for CDC42- mediated reorganization of the actin cytoskeleton and for RAC1- mediated membrane ruffling. Involved in the regulation of the actin cytoskeleton by WASF family members and the Arp2/3 complex. Plays a role in neurite growth. Acts syngeristically with ENAH to promote filipodia formation. Plays a role in the reorganization of the actin cytoskeleton in response to bacterial infection. Homodimer. Interacts with CDC42 and RAC1 that have been activated by GTP binding. Interacts with ATN1, BAI1, EPS8, SHANK1, SHANK2, SHANK3, WASF1 and WASF2. Interacts with ENAH after recruitment of CDC42. Interacts with TIAM1 and DIAPH1. Interacts (via SH3 domain) with E.coli effector protein EspF(U) (via PXXP motifs). Interacts with E.coli intimin receptor Tir. Isoform 1 and isoform 4 are expressed almost exclusively in brain. Isoform 4 is barely detectable in placenta, prostate and testis. A short isoform is ubiquitous, with the highest expression in liver, prostate, testis and placenta. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Actin-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: actin cytoskeleton; cell-cell adherens junction; cytoplasm; cytosol; plasma membrane

Molecular Function: identical protein binding; protein binding; protein C-terminus binding

Biological Process: actin crosslink formation; actin filament bundle formation; axonogenesis; insulin receptor signaling pathway; positive regulation of actin filament polymerization; regulation of actin cytoskeleton organization and biogenesis; regulation of cell shape; response to bacterium; vascular endothelial growth factor receptor signaling pathway

Research Articles on BAIAP2

Similar Products

Product Notes

The BAIAP2 baiap2 (Catalog #AAA1267744) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctgt ctcgctcaga ggagatgcac cggctcacgg aaaatgtcta taagaccatc atggagcagt tcaaccctag cctccggaac ttcatcgcca tggggaagaa ttacgagaag gcactggcag gtgtgacgta tgcagccaaa ggctactttg acgccctggt gaagatgggg gagctggcca gcgagagcca gggctccaaa gaactcggag acgttctctt ccagatggct gaagtccaca ggcagatcca gaatcagctg gaagaaatgc tgaagtcttt tcacaacgag ctgcttacgc agctggagca gaaggtggag ctggactcca ggtatctgag tgctgcgctg aagaaatacc agactgagca aaggagcaaa ggcgacgccc tggacaagtg tcaggctgag ctgaagaagc ttcggaagaa gagccagggc agcaagaatc ctcagaagta ctcggacaag gagctgcagt acatcgacgc catcagcaac aagcagggcg agctggagaa ttacgtgtcc gacggctaca agaccgcact gacagaggag cgcaggcgct tctgcttcct ggtggagaag cagtgcgccg tggccaagaa ctccgcggcc taccactcca agggcaagga gctgctggcg cagaagctgc cgctgtggca acaggcctgt gccgacccca gcaagatccc ggagcgcgcg gtgcagctca tgcagcaggt ggccagcaac ggcgccaccc tccccagcgc cctgtcggcc tccaagtcca acctggtcat ttccgacccc attccggggg ccaagcccct gccggtgccc cccgagctgg caccgttcgt ggggcggatg tctgcccagg agagcacacc catcatgaac ggcgtcacag gcccggatgg cgaggactac agcccgtggg ctgaccgcaa ggctgcccag cccaaatccc tgtctcctcc gcagtctcag agcaagctca gcgactccta ctccaacaca ctccccgtgc gcaagagcgt gaccccaaaa aacagctatg ccaccaccga gaacaagact ctgcctcgct cgagctccat ggcagccggc ctggagcgca atggccgtat gcgggtgaag gccatcttct cccacgctgc tggggacaac agcaccctcc tgagcttcaa ggagggtgac ctcattaccc tgctggtgcc tgaggcccgc gatggctggc actacggaga gagtgagaag accaagatgc ggggctggtt tcccttctcc tacacccggg tcttggacag cgatggcagt gacaggctgc acatgagcct gcagcaaggg aagagcagca gcacgggcaa cctcctggac aaggacgacc tggccatccc accccccgat tacggcgccg cctcccgggc cttccccgcc cagacggcca gcggcttcaa gcagaggccc tacagtgtgg ccgtgcccgc cttctcccag ggcctggatg actatggagc gcggtccatg agcaggtaa. It is sometimes possible for the material contained within the vial of "BAIAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.