Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAG5 cdna clone

BAG5 cDNA Clone

Gene Names
BAG5; BAG-5
Synonyms
BAG5; BAG5 cDNA Clone; BAG5 cdna clone
Ordering
For Research Use Only!
Sequence
atggatatgggaaaccaacatccttctattagtaggcttcaggaaatccaaaaggaagtaaaaagtgtagaacagcaagttatcggcttcagtggtctgtcagatgacaagaattacaagaaactggagaggattctaacaaaacagctttttgaaatagactctgtagatactgaaggaaaaggagatattcagcaagctaggaagcgggcagcacaggagacagaacgtcttctcaaagagttggagcagaatgcaaaccacccacaccggattgaaatacagaacatttttgaggaagcccagtccctcgtgagagagaaaattgtgccattttataatggaggcaactgcgtaactgatgagtttgaagaaggcatccaagatatcattctgaggctgacacatgttaaaactggaggaaaaatctccttgcggaaagcaaggtatcacactttaaccaaaatctgggcggtgcaagagataatcgaagactgcatgaaaaagcagccttccctgccgctttccgaggatgcacatccttccgttgccaaaatcaacttcgtgatgtgtgaggtgaacaaggcccgaggggtcctgattgcacttctgatgggtgtgaacaacaatgagacctgcaggcacttatcctgtgtgctctcggggctgatcgctgacctggatgctctagatgtgtgcggccggacagaaatcagaaattatcggagggaggtagtagaagatatcaacaaattattgaaatatctggatttggaagaggaagcagacacaactaaagcatttgacctgagacagaatcattccattttaaaaatagaaaaggtcctcaagagaatgagagaaataaaaaatgaacttctccaagcacaaaacccttctgaattgtacctgagctccaaaacagaattgcagggtttaattggacagttggatgaggtaagtcttgaaaaaaacccctgcatccgggaagccaggagaagagcagtgatcgaggtgcaaactctgatcacatatattgacttgaaggaggcccttgagaaaagaaagctgtttgcttgtgaggagcacccatcccataaagccgtctggaacgtccttggaaacttgtctgagatccagggagaagttctttcatttgatggaaatcgaaccgataagaactacatccggctggaagagctgctcaccaagcagctgctagccctggatgctgttgatccgcagggagaagagaagtgtaaggctgccaggaaacaagctgtgaggcttgcgcagaatattctcagctatctcgacctgaaatctgatgaatgggagtactga
Sequence Length
1344
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,027 Da
NCBI Official Full Name
Homo sapiens BCL2-associated athanogene 5, mRNA
NCBI Official Synonym Full Names
BCL2 associated athanogene 5
NCBI Official Symbol
BAG5
NCBI Official Synonym Symbols
BAG-5
NCBI Protein Information
BAG family molecular chaperone regulator 5
UniProt Protein Name
BAG family molecular chaperone regulator 5
UniProt Gene Name
BAG5
UniProt Synonym Gene Names
KIAA0873; BAG-5
UniProt Entry Name
BAG5_HUMAN

NCBI Description

The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

BAG5: Inhibits both auto-ubiquitination of PARK2 and ubiquitination of target proteins by PARK2. May function as a nucleotide exchange factor for HSP/HSP70, promoting ADP release, and activating Hsp70-mediated refolding. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 14q32.33

Cellular Component: cytosol; inclusion body; membrane; mitochondrion; nucleus; perinuclear region of cytoplasm

Molecular Function: adenyl-nucleotide exchange factor activity; chaperone binding; protein binding; protein kinase binding; ubiquitin protein ligase binding

Biological Process: Golgi organization and biogenesis; negative regulation of proteasomal ubiquitin-dependent protein catabolic process; negative regulation of protein ubiquitination; negative regulation of ubiquitin-protein ligase activity; protein folding; regulation of ubiquitin-protein ligase activity

Research Articles on BAG5

Similar Products

Product Notes

The BAG5 bag5 (Catalog #AAA1272516) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatatgg gaaaccaaca tccttctatt agtaggcttc aggaaatcca aaaggaagta aaaagtgtag aacagcaagt tatcggcttc agtggtctgt cagatgacaa gaattacaag aaactggaga ggattctaac aaaacagctt tttgaaatag actctgtaga tactgaagga aaaggagata ttcagcaagc taggaagcgg gcagcacagg agacagaacg tcttctcaaa gagttggagc agaatgcaaa ccacccacac cggattgaaa tacagaacat ttttgaggaa gcccagtccc tcgtgagaga gaaaattgtg ccattttata atggaggcaa ctgcgtaact gatgagtttg aagaaggcat ccaagatatc attctgaggc tgacacatgt taaaactgga ggaaaaatct ccttgcggaa agcaaggtat cacactttaa ccaaaatctg ggcggtgcaa gagataatcg aagactgcat gaaaaagcag ccttccctgc cgctttccga ggatgcacat ccttccgttg ccaaaatcaa cttcgtgatg tgtgaggtga acaaggcccg aggggtcctg attgcacttc tgatgggtgt gaacaacaat gagacctgca ggcacttatc ctgtgtgctc tcggggctga tcgctgacct ggatgctcta gatgtgtgcg gccggacaga aatcagaaat tatcggaggg aggtagtaga agatatcaac aaattattga aatatctgga tttggaagag gaagcagaca caactaaagc atttgacctg agacagaatc attccatttt aaaaatagaa aaggtcctca agagaatgag agaaataaaa aatgaacttc tccaagcaca aaacccttct gaattgtacc tgagctccaa aacagaattg cagggtttaa ttggacagtt ggatgaggta agtcttgaaa aaaacccctg catccgggaa gccaggagaa gagcagtgat cgaggtgcaa actctgatca catatattga cttgaaggag gcccttgaga aaagaaagct gtttgcttgt gaggagcacc catcccataa agccgtctgg aacgtccttg gaaacttgtc tgagatccag ggagaagttc tttcatttga tggaaatcga accgataaga actacatccg gctggaagag ctgctcacca agcagctgct agccctggat gctgttgatc cgcagggaga agagaagtgt aaggctgcca ggaaacaagc tgtgaggctt gcgcagaata ttctcagcta tctcgacctg aaatctgatg aatgggagta ctga. It is sometimes possible for the material contained within the vial of "BAG5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.