Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

BAG3 cdna clone

BAG3 cDNA Clone

Gene Names
BAG3; BIS; BAG-3; CAIR-1
Synonyms
BAG3; BAG3 cDNA Clone; BAG3 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgagcgccgccacccactcgcccatgatgcaggtggcgtccggcaacggtgaccgcgaccctttgccccccggatgggagatcaagatcgacccgcagaccggctggcccttcttcgtggaccacaacagccgcaccactacgtggaacgacccgcgcgtgccctctgagggccccaaggagactccatcctctgccaatggcccttcccgggagggctctaggctgccgcctgctagggaaggccaccctgtgtacccccagctccgaccaggctacattcccattcctgtgctccatgaaggcgctgagaaccggcaggtgcaccctttccatgtctatccccagcctgggatgcagcgattccgaactgaggcggcagcagcggctcctcagaggtcccagtcacctctgcggggcatgccagaaaccactcagccagataaacagtgtggacaggtggcagcggcggcggcagcccagcccccagcctcccacggacctgagcggtcccagtctccagctgcctctgactgctcatcctcatcctcctcggccagcctgccttcctccggcaggagcagcctgggcagtcaccagctcccgcgggggtacatctccattccggtgatacacgagcagaacgttacccggccagcagcccagccctccttccaccaagcccagaagacgcactacccagcgcagcagggggagtaccagacccaccagcctgtgtaccacaagatccagggggatgactgggagccccggcccctgcgggcggcatccccgttcaggtcatctgtccagggtgcatcgagccgggagggctcaccagccaggagcagcacgccactccactccccctcgcccatccgtgtgcacaccgtggtcgacaggcctcagcagcccatgacccatcgagaaactgcacctgtttcccagcctgaaaacaaaccagaaagtaagccaggcccagttggaccagaactccctcctggacacatcccaattcaagtgatccgcaaagaggtggattctaaacctgtttcccagaagcccccacctccctctgagaaggtagaggtgaaagttccccctgctccagttccttgtcctcctcccagccctggcccttctgctgtcccctcttcccccaagagtgtggctacagaagagagggcagcccccagcactgcccctgcagaagctacacctccaaaaccaggagaagccgaggctcccccaaaacatccaggagtgctgaaagtggaagccatcctggagaaggtgcaggggctggagcaggctgtagacaactttgaaggcaagaagactgacaaaaagtacctgatgatcgaagagtatttgaccaaagagctgctggccctggattcagtggaccccgagggacgagccgatgtgcgtcaggccaggagagacggtgtcaggaaggttcagaccatcttggaaaaacttgaacagaaagccattgatgtcccaggtcaagtccaggtctatgaactccagcccagcaaccttgaagcagatcagccactgcaggcaatcatggagatgggtgccgtggcagcagacaagggcaagaaaaatgctggaaatgcagaagatccccacacagaaacccagcagccagaagccacagcagcagcgacttcaaaccccagcagcatgacagacacccctggtaacccagcagcaccgtag
Sequence Length
1728
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
61,595 Da
NCBI Official Full Name
Homo sapiens BCL2-associated athanogene 3, mRNA
NCBI Official Synonym Full Names
BCL2-associated athanogene 3
NCBI Official Symbol
BAG3
NCBI Official Synonym Symbols
BIS; BAG-3; CAIR-1
NCBI Protein Information
BAG family molecular chaperone regulator 3; docking protein CAIR-1; BCL2-binding athanogene 3; bcl-2-binding protein Bis
UniProt Protein Name
BAG family molecular chaperone regulator 3
UniProt Gene Name
BAG3
UniProt Synonym Gene Names
BIS; BAG-3
UniProt Entry Name
BAG3_HUMAN

NCBI Description

BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]

Uniprot Description

BAG3: Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release. Has anti-apoptotic activity. Defects in BAG3 are the cause of myopathy myofibrillar type 6 (MFM6). A neuromuscular disorder that results in early-onset, severe, progressive, diffuse muscle weakness associated with cardiomyopathy, severe respiratory insufficiency during adolescence, and a rigid spine in some patients. At ultrastructural level, muscle fibers display structural alterations consisting of replacement of the normal myofibrillar markings by small, dense granules, or larger hyaline masses, or amorphous material. Defects in BAG3 are the cause of cardiomyopathy dilated type 1HH (CMD1HH). CMD1HH is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 10q25.2-q26.2

Cellular Component: neuron projection; cytoplasm; plasma membrane; Z disc; cytosol

Molecular Function: protein binding; chaperone binding; protein complex binding

Biological Process: protein stabilization; induction of apoptosis via death domain receptors; protein folding; spinal cord development; brain development; negative regulation of apoptosis

Disease: Myopathy, Myofibrillar, 6; Cardiomyopathy, Dilated, 1hh

Research Articles on BAG3

Similar Products

Product Notes

The BAG3 bag3 (Catalog #AAA1274168) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgccg ccacccactc gcccatgatg caggtggcgt ccggcaacgg tgaccgcgac cctttgcccc ccggatggga gatcaagatc gacccgcaga ccggctggcc cttcttcgtg gaccacaaca gccgcaccac tacgtggaac gacccgcgcg tgccctctga gggccccaag gagactccat cctctgccaa tggcccttcc cgggagggct ctaggctgcc gcctgctagg gaaggccacc ctgtgtaccc ccagctccga ccaggctaca ttcccattcc tgtgctccat gaaggcgctg agaaccggca ggtgcaccct ttccatgtct atccccagcc tgggatgcag cgattccgaa ctgaggcggc agcagcggct cctcagaggt cccagtcacc tctgcggggc atgccagaaa ccactcagcc agataaacag tgtggacagg tggcagcggc ggcggcagcc cagcccccag cctcccacgg acctgagcgg tcccagtctc cagctgcctc tgactgctca tcctcatcct cctcggccag cctgccttcc tccggcagga gcagcctggg cagtcaccag ctcccgcggg ggtacatctc cattccggtg atacacgagc agaacgttac ccggccagca gcccagccct ccttccacca agcccagaag acgcactacc cagcgcagca gggggagtac cagacccacc agcctgtgta ccacaagatc cagggggatg actgggagcc ccggcccctg cgggcggcat ccccgttcag gtcatctgtc cagggtgcat cgagccggga gggctcacca gccaggagca gcacgccact ccactccccc tcgcccatcc gtgtgcacac cgtggtcgac aggcctcagc agcccatgac ccatcgagaa actgcacctg tttcccagcc tgaaaacaaa ccagaaagta agccaggccc agttggacca gaactccctc ctggacacat cccaattcaa gtgatccgca aagaggtgga ttctaaacct gtttcccaga agcccccacc tccctctgag aaggtagagg tgaaagttcc ccctgctcca gttccttgtc ctcctcccag ccctggccct tctgctgtcc cctcttcccc caagagtgtg gctacagaag agagggcagc ccccagcact gcccctgcag aagctacacc tccaaaacca ggagaagccg aggctccccc aaaacatcca ggagtgctga aagtggaagc catcctggag aaggtgcagg ggctggagca ggctgtagac aactttgaag gcaagaagac tgacaaaaag tacctgatga tcgaagagta tttgaccaaa gagctgctgg ccctggattc agtggacccc gagggacgag ccgatgtgcg tcaggccagg agagacggtg tcaggaaggt tcagaccatc ttggaaaaac ttgaacagaa agccattgat gtcccaggtc aagtccaggt ctatgaactc cagcccagca accttgaagc agatcagcca ctgcaggcaa tcatggagat gggtgccgtg gcagcagaca agggcaagaa aaatgctgga aatgcagaag atccccacac agaaacccag cagccagaag ccacagcagc agcgacttca aaccccagca gcatgacaga cacccctggt aacccagcag caccgtag. It is sometimes possible for the material contained within the vial of "BAG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual