Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAG1 cdna clone

BAG1 cDNA Clone

Gene Names
BAG1; HAP; BAG-1; RAP46
Synonyms
BAG1; BAG1 cDNA Clone; BAG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaagaaaacccggcgccgctcgacccggagcgaggagttgacccggagcgaggagttgaccctgagtgaggaagcgacctggagtgaagaggcgacccagagtgaggaggcgacccagggcgaagagatgaatcggagccaggaggtgacccgggacgaggagtcgacccggagcgaggaggtgaccagggaggaaatggcggcagctgggctcaccgtgactgtcacccacagcaatgagaagcacgaccttcatgttacctcccagcagggcagcagtgaaccagttgtccaagacctggcccaggttgttgaagaggtcataggggttccacagtcttttcagaaactcatatttaagggaaaatctctgaaggaaatggaaacaccgttgtcagcacttggaatacaagatggttgccgggtcatgttaattgggaaaaagaacagtccacaggaagaggttgaactaaagaagttgaaacatttggagaagtctgtggagaagatagctgaccagctggaagagttgaataaagagcttactggaatccagcagggttttctgcccaaggatttgcaagctgaagctctctgcaaacttgataggagagtaaaagccacaatagagcagtttatgaagatcttggaggagattgacacactgatcctgccagaaaatttcaaagacagtagattgaaaaggaaaggcttggtaaaaaaggttcaggcattcctagccgagtgtgacacagtggagcagaacatctgccaggagactgagcggctgcagtctacaaactttgccctggccgagtga
Sequence Length
825
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
573
Molecular Weight
25,989 Da
NCBI Official Full Name
Homo sapiens BCL2-associated athanogene, mRNA
NCBI Official Synonym Full Names
BCL2 associated athanogene 1
NCBI Official Symbol
BAG1
NCBI Official Synonym Symbols
HAP; BAG-1; RAP46
NCBI Protein Information
BAG family molecular chaperone regulator 1
UniProt Protein Name
BAG family molecular chaperone regulator 1
UniProt Gene Name
BAG1
UniProt Synonym Gene Names
HAP; BAG-1
UniProt Entry Name
BAG1_HUMAN

NCBI Description

The oncogene BCL2 is a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. The protein encoded by this gene binds to BCL2 and is referred to as BCL2-associated athanogene. It enhances the anti-apoptotic effects of BCL2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. Multiple protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) initiation codon, and three alternative downstream AUG initiation codons. A related pseudogene has been defined on chromosome X. [provided by RefSeq, Feb 2010]

Uniprot Description

BAG1: Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release. Inhibits the pro-apoptotic function of PPP1R15A, and has anti-apoptotic activity. Markedly increases the anti-cell death function of BCL2 induced by various stimuli. Homodimer. Forms a heteromeric complex with HSP70/HSC70. Binds to the ATPase domain of HSP/HSC70 chaperones. Isoform 1, isoform 3 and isoform 4 but not isoform 2 interact with HSPA8/HSC70. Interacts with NR3C1. Interacts with the N-terminal region of STK19. Interacts with PPP1R15A. Interacts with BCL2 in an ATP-dependent manner. Isoform 2 does not interact with BCL2. Up-regulated during differentiation of bladder epithelial cells and down-regulated during differentiation of prostate epithelium. Isoform 4 is the most abundantly expressed isoform. It is ubiquitously expressed throughout most tissues, except the liver, colon, breast and uterine myometrium. Isoform 1 is expressed in the ovary and testis. Isoform 4 is expressed in several types of tumor cell lines, and at consistently high levels in leukemia and lymphoma cell lines. Isoform 1 is expressed in the prostate, breast and leukemia cell lines. Isoform 3 is the least abundant isoform in tumor cell lines. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 9p12

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: adenyl-nucleotide exchange factor activity; protein binding; receptor signaling protein activity

Biological Process: cell surface receptor linked signal transduction; negative regulation of apoptosis

Research Articles on BAG1

Similar Products

Product Notes

The BAG1 bag1 (Catalog #AAA1268199) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaaga aaacccggcg ccgctcgacc cggagcgagg agttgacccg gagcgaggag ttgaccctga gtgaggaagc gacctggagt gaagaggcga cccagagtga ggaggcgacc cagggcgaag agatgaatcg gagccaggag gtgacccggg acgaggagtc gacccggagc gaggaggtga ccagggagga aatggcggca gctgggctca ccgtgactgt cacccacagc aatgagaagc acgaccttca tgttacctcc cagcagggca gcagtgaacc agttgtccaa gacctggccc aggttgttga agaggtcata ggggttccac agtcttttca gaaactcata tttaagggaa aatctctgaa ggaaatggaa acaccgttgt cagcacttgg aatacaagat ggttgccggg tcatgttaat tgggaaaaag aacagtccac aggaagaggt tgaactaaag aagttgaaac atttggagaa gtctgtggag aagatagctg accagctgga agagttgaat aaagagctta ctggaatcca gcagggtttt ctgcccaagg atttgcaagc tgaagctctc tgcaaacttg ataggagagt aaaagccaca atagagcagt ttatgaagat cttggaggag attgacacac tgatcctgcc agaaaatttc aaagacagta gattgaaaag gaaaggcttg gtaaaaaagg ttcaggcatt cctagccgag tgtgacacag tggagcagaa catctgccag gagactgagc ggctgcagtc tacaaacttt gccctggccg agtga. It is sometimes possible for the material contained within the vial of "BAG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.