Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAD cdna clone

BAD cDNA Clone

Gene Names
BAD; BBC2; BCL2L8
Synonyms
BAD; BAD cDNA Clone; BAD cdna clone
Ordering
For Research Use Only!
Sequence
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtga
Sequence Length
507
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
572
Molecular Weight
18,392 Da
NCBI Official Full Name
Homo sapiens BCL2-associated agonist of cell death, mRNA
NCBI Official Synonym Full Names
BCL2 associated agonist of cell death
NCBI Official Symbol
BAD
NCBI Official Synonym Symbols
BBC2; BCL2L8
NCBI Protein Information
bcl2-associated agonist of cell death
UniProt Protein Name
Bcl2-associated agonist of cell death
UniProt Gene Name
BAD
UniProt Synonym Gene Names
BBC6; BCL2L8; BAD; Bcl2-L-8
UniProt Entry Name
BAD_HUMAN

NCBI Description

The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008]

Uniprot Description

BAD: a proapoptotic member of the Bcl-2 family. Displaces Bax from binding to Bcl-2 and Bcl-xL, resulting in cell death. Survival factors such as IL-3 can inhibit the apoptotic activity of Bad inducing the phosphorylation of Bad by Akt and p90RSK. 14-3-3 proteins bind phosphorylated Bad, inhibiting its binding to Bcl-2 and Bcl-xL. Phosphorylation by mitochondria-anchored PKA in the BH3 domain can block the dimerization of Bad and Bcl-xL.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: cytosol; mitochondrial outer membrane; mitochondrion

Molecular Function: caspase activator activity; lipid binding; phospholipid binding; protein binding; protein kinase binding

Biological Process: ADP metabolic process; apoptosis; ATP metabolic process; caspase activation; glucose homeostasis; negative regulation of cytolysis; pore complex biogenesis; positive regulation of apoptosis; positive regulation of autophagy; positive regulation of caspase activity; positive regulation of epithelial cell proliferation; positive regulation of glucokinase activity; positive regulation of insulin secretion; positive regulation of proteolysis; protein insertion into mitochondrial membrane during induction of apoptosis; regulation of mitochondrial membrane permeability

Research Articles on BAD

Similar Products

Product Notes

The BAD bad (Catalog #AAA1276583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccaga tcccagagtt tgagccgagt gagcaggaag actccagctc tgcagagagg ggcctgggcc ccagccccgc aggggacggg ccctcaggct ccggcaagca tcatcgccag gccccaggcc tcctgtggga cgccagtcac cagcaggagc agccaaccag cagcagccat catggaggcg ctggggctgt ggagatccgg agtcgccaca gctcctaccc cgcggggacg gaggacgacg aagggatggg ggaggagccc agcccctttc ggggccgctc gcgctcggcg ccccccaacc tctgggcagc acagcgctat ggccgcgagc tccggaggat gagtgacgag tttgtggact cctttaagaa gggacttcct cgcccgaaga gcgcgggcac agcaacgcag atgcggcaaa gctccagctg gacgcgagtc ttccagtcct ggtgggatcg gaacttgggc aggggaagct ccgccccctc ccagtga. It is sometimes possible for the material contained within the vial of "BAD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.