Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAAT cdna clone

BAAT cDNA Clone

Gene Names
BAAT; BAT; BACAT
Synonyms
BAAT; BAAT cDNA Clone; BAAT cdna clone
Ordering
For Research Use Only!
Sequence
atgatccagttgacagctacccctgtgagtgcacttgttgatgagccagtgcatatccaagctacaggcctgattccctttcagatggtgagttttcaggcatcactggaagatgaaaacggagacatgttttattctcaagcccactatagggccaatgaattcggtgaggtggacctgaatcatgcttcttcacttggaggggattatatgggagtccaccccatgggtctcttctggtctctgaaacctgaaaagctattaacaagactgttgaaaagagatgtgatgaataggcctttccaggtccaagtaaaactttatgacttagagttaatagtgaacaataaagttgccagtgctccaaaggccagcctgactttggagaggtggtatgtggcacctggtgtcacacgaattaaggttcgagaaggccgccttcgaggagctctctttctccctccaggagagggtctcttcccaggggtaattgatttgtttggtggtttgggtgggctgcttgaatttcgggccagcctcctagccagtcgtggcttcgcctccttggccttggcttaccataactatgaagacctgccccgcaaaccagaagtaacagatttggaatattttgaggaggctgccaactttctcctgagacatccaaaggtctttggctcaggcgttggggtagtctctgtatgtcaaggagtacagattggactatctatggctatttacctaaagcaagtcacagccacggtacttattaatgggaccaactttccttttggcattccacaggtatatcatggtcagatccatcagccccttccccattctgcacaattaatatccaccaatgccttggggttactagagctctatcgcacttttgagacaactcaagttggggccagtcaatatttgtttcctattgaagaggcccaggggcaattcctcttcattgtaggagaaggtgataagactatcaacagcaaagcacacgctgaacaagccataggacagctgaagagacatgggaagaacaactggaccctgctatcttaccctggggcaggccacctgatagaacctccctattctcctctgtgctgtgcctcaacgacccacgatttgaggttacactggggaggagaggtgatcccacacgcagctgcacaggaacatgcttggaaggagatccagagatttctcaggaagcacctcattccagatgtgaccagtcaactctaa
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
570
Molecular Weight
46,299 Da
NCBI Official Full Name
Homo sapiens bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase), mRNA
NCBI Official Synonym Full Names
bile acid-CoA:amino acid N-acyltransferase
NCBI Official Symbol
BAAT
NCBI Official Synonym Symbols
BAT; BACAT
NCBI Protein Information
bile acid-CoA:amino acid N-acyltransferase
UniProt Protein Name
Bile acid-CoA:amino acid N-acyltransferase
UniProt Gene Name
BAAT
UniProt Synonym Gene Names
BAT
UniProt Entry Name
BAAT_HUMAN

NCBI Description

The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

BAAT: Involved in bile acid metabolism. In liver hepatocytes catalyzes the second step in the conjugation of C24 bile acids (choloneates) to glycine and taurine before excretion into bile canaliculi. The major components of bile are cholic acid and chenodeoxycholic acid. In a first step the bile acids are converted to an acyl-CoA thioester, either in peroxisomes (primary bile acids deriving from the cholesterol pathway), or cytoplasmic at the endoplasmic reticulum (secondary bile acids). May catalyze the conjugation of primary or secondary bile acids, or both. The conjugation increases the detergent properties of bile acids in the intestine, which facilitates lipid and fat-soluble vitamin absorption. In turn, bile acids are deconjugated by bacteria in the intestine and are recycled back to the liver for reconjugation (secondary bile acids). May also act as an acyl-CoA thioesterase that regulates intracellular levels of free fatty acids. In vitro, catalyzes the hydrolysis of long- and very long-chain saturated acyl-CoAs to the free fatty acid and coenzyme A (CoASH), and conjugates glycine to these acyl-CoAs. Defects in BAAT are involved in familial hypercholanemia (FHCA). FHCA is a disorder characterized by elevated serum bile acid concentrations, itching, and fat malabsorption. Belongs to the C/M/P thioester hydrolase family.

Protein type: Other Amino Acids Metabolism - taurine and hypotaurine; Lipid Metabolism - primary bile acid biosynthesis; EC 2.3.1.65; Hydrolase; Transferase; EC 3.1.2.2; Lipid Metabolism - unsaturated fatty acid biosynthesis

Chromosomal Location of Human Ortholog: 9q22.3

Cellular Component: cytosol; peroxisomal matrix; peroxisome

Molecular Function: glycine N-choloyltransferase activity; N-acyltransferase activity; protein binding; receptor binding; transferase activity, transferring acyl groups

Biological Process: acyl-CoA metabolic process; bile acid biosynthetic process; bile acid metabolic process; glycine metabolic process; taurine metabolic process

Disease: Hypercholanemia, Familial

Research Articles on BAAT

Similar Products

Product Notes

The BAAT baat (Catalog #AAA1270276) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccagt tgacagctac ccctgtgagt gcacttgttg atgagccagt gcatatccaa gctacaggcc tgattccctt tcagatggtg agttttcagg catcactgga agatgaaaac ggagacatgt tttattctca agcccactat agggccaatg aattcggtga ggtggacctg aatcatgctt cttcacttgg aggggattat atgggagtcc accccatggg tctcttctgg tctctgaaac ctgaaaagct attaacaaga ctgttgaaaa gagatgtgat gaataggcct ttccaggtcc aagtaaaact ttatgactta gagttaatag tgaacaataa agttgccagt gctccaaagg ccagcctgac tttggagagg tggtatgtgg cacctggtgt cacacgaatt aaggttcgag aaggccgcct tcgaggagct ctctttctcc ctccaggaga gggtctcttc ccaggggtaa ttgatttgtt tggtggtttg ggtgggctgc ttgaatttcg ggccagcctc ctagccagtc gtggcttcgc ctccttggcc ttggcttacc ataactatga agacctgccc cgcaaaccag aagtaacaga tttggaatat tttgaggagg ctgccaactt tctcctgaga catccaaagg tctttggctc aggcgttggg gtagtctctg tatgtcaagg agtacagatt ggactatcta tggctattta cctaaagcaa gtcacagcca cggtacttat taatgggacc aactttcctt ttggcattcc acaggtatat catggtcaga tccatcagcc ccttccccat tctgcacaat taatatccac caatgccttg gggttactag agctctatcg cacttttgag acaactcaag ttggggccag tcaatatttg tttcctattg aagaggccca ggggcaattc ctcttcattg taggagaagg tgataagact atcaacagca aagcacacgc tgaacaagcc ataggacagc tgaagagaca tgggaagaac aactggaccc tgctatctta ccctggggca ggccacctga tagaacctcc ctattctcct ctgtgctgtg cctcaacgac ccacgatttg aggttacact ggggaggaga ggtgatccca cacgcagctg cacaggaaca tgcttggaag gagatccaga gatttctcag gaagcacctc attccagatg tgaccagtca actctaa. It is sometimes possible for the material contained within the vial of "BAAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.