Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

B4GALT7 cdna clone

B4GALT7 cDNA Clone

Gene Names
B4GALT7; EDSP1; XGPT1; EDSSLA; XGALT1
Synonyms
B4GALT7; B4GALT7 cDNA Clone; B4GALT7 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcccctcgcggaggaaagcggcgcagctgccctgggaggacggcaggtccgggttgctctccggcggcctccctcggaagtgttccgtcttccacctgttcgtggcctgcctctcgctgggcttcttctccctactctggctgcagctcagctgctctggggacgtggcccgggcagtcaggggacaagggcaggagacctcgggccctccccgcgcctgccccccagagccgccccctgagcactgggaagaagacgcatcctggggcccccaccgcctggcagtgctggtgcccttccgcgaacgcttcgaggagctcctggtcttcgtgccccacatgcgccgcttcctgagcaggaagaagatccggcaccacatctacgtgctcaaccaggtggaccacttcaggttcaaccgggcagcgctcatcaacgtgggcttcctggagagcagcaacagcacggactacattgccatgcacgacgttgacctgctccctctcaacgaggagctggactatggctttcctgaggctgggcccttccacgtggcctccccggagctccaccctctctaccactacaagacctatgtcggcggcatcctgctgctctccaagcagcactaccggctgtgcaatgggatgtccaaccgcttctggggctggggccgcgaggacgacgagttctaccggcgcattaagggagctgggctccagcttttccgcccctcgggaatcacaactgggtacaagacatttcgccacctgcatgacccagcctggcggaagagggaccagaagcgcatcgcagctcaaaaacaggagcagttcaaggtggacagggagggaggcctgaacactgtgaagtaccatgtggcttcccgcactgccctgtctgtgggcggggccccctgcactgtcctcaacatcatgttggactgtgacaagaccgccacaccctggtgcacattcagctga
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,406 Da
NCBI Official Full Name
Homo sapiens xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I), mRNA
NCBI Official Synonym Full Names
beta-1,4-galactosyltransferase 7
NCBI Official Symbol
B4GALT7
NCBI Official Synonym Symbols
EDSP1; XGPT1; EDSSLA; XGALT1
NCBI Protein Information
beta-1,4-galactosyltransferase 7
UniProt Protein Name
Beta-1,4-galactosyltransferase 7
UniProt Gene Name
B4GALT7
UniProt Synonym Gene Names
XGALT1; Beta-1,4-GalTase 7; Beta4Gal-T7; b4Gal-T7
UniProt Entry Name
B4GT7_HUMAN

NCBI Description

This gene is a member of the beta-1,4-galactosyltransferase (beta4GalT) family. Family members encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose. Each beta4GalT member has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus which then remains uncleaved to function as a transmembrane anchor. The enzyme encoded by this gene attaches the first galactose in the common carbohydrate-protein linkage (GlcA-beta1,3-Gal-beta1,3-Gal-beta1,4-Xyl-beta1-O-Ser) found in proteoglycans. This enzyme differs from other beta4GalTs because it lacks the conserved Cys residues found in beta4GalT1-beta4GalT6 and it is located in cis-Golgi instead of trans-Golgi. Mutations in this gene have been associated with the progeroid form of Ehlers-Danlos syndrome. [provided by RefSeq, Oct 2009]

Uniprot Description

B4GALT7: Required for the biosynthesis of the tetrasaccharide linkage region of proteoglycans, especially for small proteoglycans in skin fibroblasts. Defects in B4GALT7 are the cause of Ehlers-Danlos syndrome progeroid type (EDSP). EDSP is a variant form of Ehlers-Danlos syndrome characterized by progeroid facies, mild mental retardation, short stature, skin hyperextensibility, moderate skin fragility, joint hypermobility principally in digits. Belongs to the glycosyltransferase 7 family.

Protein type: Transferase; EC 2.4.1.133; Glycan Metabolism - chondroitin sulfate biosynthesis; Glycan Metabolism - heparan sulfate biosynthesis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q35.2-q35.3

Cellular Component: Golgi apparatus; Golgi membrane; integral to membrane

Molecular Function: beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity; galactosyltransferase activity; manganese ion binding; protein binding; xylosylprotein 4-beta-galactosyltransferase activity

Biological Process: fibril organization and biogenesis; glycosaminoglycan biosynthetic process; glycosaminoglycan metabolic process; negative regulation of fibroblast proliferation; protein amino acid N-linked glycosylation; protein modification process; proteoglycan metabolic process

Disease: Ehlers-danlos Syndrome, Progeroid Type, 1

Research Articles on B4GALT7

Similar Products

Product Notes

The B4GALT7 b4galt7 (Catalog #AAA1265982) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcccct cgcggaggaa agcggcgcag ctgccctggg aggacggcag gtccgggttg ctctccggcg gcctccctcg gaagtgttcc gtcttccacc tgttcgtggc ctgcctctcg ctgggcttct tctccctact ctggctgcag ctcagctgct ctggggacgt ggcccgggca gtcaggggac aagggcagga gacctcgggc cctccccgcg cctgcccccc agagccgccc cctgagcact gggaagaaga cgcatcctgg ggcccccacc gcctggcagt gctggtgccc ttccgcgaac gcttcgagga gctcctggtc ttcgtgcccc acatgcgccg cttcctgagc aggaagaaga tccggcacca catctacgtg ctcaaccagg tggaccactt caggttcaac cgggcagcgc tcatcaacgt gggcttcctg gagagcagca acagcacgga ctacattgcc atgcacgacg ttgacctgct ccctctcaac gaggagctgg actatggctt tcctgaggct gggcccttcc acgtggcctc cccggagctc caccctctct accactacaa gacctatgtc ggcggcatcc tgctgctctc caagcagcac taccggctgt gcaatgggat gtccaaccgc ttctggggct ggggccgcga ggacgacgag ttctaccggc gcattaaggg agctgggctc cagcttttcc gcccctcggg aatcacaact gggtacaaga catttcgcca cctgcatgac ccagcctggc ggaagaggga ccagaagcgc atcgcagctc aaaaacagga gcagttcaag gtggacaggg agggaggcct gaacactgtg aagtaccatg tggcttcccg cactgccctg tctgtgggcg gggccccctg cactgtcctc aacatcatgt tggactgtga caagaccgcc acaccctggt gcacattcag ctga. It is sometimes possible for the material contained within the vial of "B4GALT7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.