Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

B3GNT2 cdna clone

B3GNT2 cDNA Clone

Gene Names
B3GNT2; B3GNT; BGNT2; B3GNT1; BGnT-2; beta-1; 3-Gn-T1; 3-Gn-T2; B3GN-T2; B3GNT-2; BETA3GNT; beta3Gn-T1; beta3Gn-T2
Synonyms
B3GNT2; B3GNT2 cDNA Clone; B3GNT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgttggacgtcgaagaataaagttgttgggtatcctgatgatggcaaatgtcttcatttattttattatggaagtctccaaaagcagtagccaagaaaaaaatggaaaaggggaagtaataatacccaaagagaagttctggaagatatctacccctcccgaggcatactggaaccgagagcaagagaagctgaaccggcagtacaaccccatcctgagcatgctgaccaaccagacgggggaggcgggcaggctctccaatataagccatctgaactactgcgaacctgacctgagggtcacgtcggtggttacgggttttaacaacttgccggacagatttaaagactttctgctgtatttgagatgccgcaattattcactgcttatagatcagccggataagtgtgcaaagaaacctttcttgttgctggcgattaagtccctcactccacattttgccagaaggcaagcaatccgggaatcctggggccaagaaagcaacgcagggaaccaaacggtggtgcgagtcttcctgctgggccagacacccccagaggacaaccaccccgacctttcagatatgctgaaatttgagagtgagaagcaccaagacattcttatgtggaactacagagacactttcttcaacttgtctctgaaggaagtgctgtttctcaggtgggtaagtacttcctgcccagacactgagtttgttttcaagggcgatgacgatgtttttgtgaacacccatcacatcctgaattacttgaatagtttatccaagaccaaagccaaagatctcttcataggtgatgtgatccacaatgctggacctcatcgggataagaagctgaagtactacatcccagaagttgtttactctggcctctacccaccctatgcagggggaggggggttcctctactccggccacctggccctgaggctgtaccatatcactgaccaggtccatctctaccccattgatgacgtttatactggaatgtgccttcagaaactcggcctcgttccagagaaacacaaaggcttcaggacatttgatatcgaggagaaaaacaaaaataacatctgctcctatgtagatctgatgttagtacatagtagaaaacctcaagagatgattgatatttggtctcagttgcagagtgctcatttaaaatgctaa
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,484 Da
NCBI Official Full Name
Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2, mRNA
NCBI Official Synonym Full Names
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
NCBI Official Symbol
B3GNT2
NCBI Official Synonym Symbols
B3GNT; BGNT2; B3GNT1; BGnT-2; beta-1; 3-Gn-T1; 3-Gn-T2; B3GN-T2; B3GNT-2; BETA3GNT; beta3Gn-T1; beta3Gn-T2
NCBI Protein Information
N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase 2
UniProt Protein Name
N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase 2
UniProt Gene Name
B3GNT2
UniProt Synonym Gene Names
B3GALT7; B3GNT1; BGnT-1; Beta-1,3-Gn-T1; Beta3Gn-T1; Beta-1,3-GalTase 7; Beta3Gal-T7; Beta3GalT7; b3Gal-T7; BGnT-2; Beta-1,3-Gn-T2; Beta-1,3-N-acetylglucosaminyltransferase 2; Beta3Gn-T2
UniProt Entry Name
B3GN2_HUMAN

NCBI Description

This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It prefers the substrate of lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

B3GNT2: Catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Belongs to the glycosyltransferase 31 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Glycan Metabolism - glycosphingolipid biosynthesis - lacto and neolacto series; Membrane protein, integral; Transferase; EC 2.4.1.-; Motility/polarity/chemotaxis; Glycan Metabolism - keratan sulfate biosynthesis; Cell development/differentiation

Chromosomal Location of Human Ortholog: 2p15

Cellular Component: Golgi membrane

Molecular Function: N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity; UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity

Biological Process: keratan sulfate biosynthetic process; O-glycan processing; poly-N-acetyllactosamine biosynthetic process

Research Articles on B3GNT2

Similar Products

Product Notes

The B3GNT2 b3gnt2 (Catalog #AAA1268809) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgttg gacgtcgaag aataaagttg ttgggtatcc tgatgatggc aaatgtcttc atttatttta ttatggaagt ctccaaaagc agtagccaag aaaaaaatgg aaaaggggaa gtaataatac ccaaagagaa gttctggaag atatctaccc ctcccgaggc atactggaac cgagagcaag agaagctgaa ccggcagtac aaccccatcc tgagcatgct gaccaaccag acgggggagg cgggcaggct ctccaatata agccatctga actactgcga acctgacctg agggtcacgt cggtggttac gggttttaac aacttgccgg acagatttaa agactttctg ctgtatttga gatgccgcaa ttattcactg cttatagatc agccggataa gtgtgcaaag aaacctttct tgttgctggc gattaagtcc ctcactccac attttgccag aaggcaagca atccgggaat cctggggcca agaaagcaac gcagggaacc aaacggtggt gcgagtcttc ctgctgggcc agacaccccc agaggacaac caccccgacc tttcagatat gctgaaattt gagagtgaga agcaccaaga cattcttatg tggaactaca gagacacttt cttcaacttg tctctgaagg aagtgctgtt tctcaggtgg gtaagtactt cctgcccaga cactgagttt gttttcaagg gcgatgacga tgtttttgtg aacacccatc acatcctgaa ttacttgaat agtttatcca agaccaaagc caaagatctc ttcataggtg atgtgatcca caatgctgga cctcatcggg ataagaagct gaagtactac atcccagaag ttgtttactc tggcctctac ccaccctatg cagggggagg ggggttcctc tactccggcc acctggccct gaggctgtac catatcactg accaggtcca tctctacccc attgatgacg tttatactgg aatgtgcctt cagaaactcg gcctcgttcc agagaaacac aaaggcttca ggacatttga tatcgaggag aaaaacaaaa ataacatctg ctcctatgta gatctgatgt tagtacatag tagaaaacct caagagatga ttgatatttg gtctcagttg cagagtgctc atttaaaatg ctaa. It is sometimes possible for the material contained within the vial of "B3GNT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.