Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AZIN1 cdna clone

AZIN1 cDNA Clone

Gene Names
AZIN1; AZI; OAZI; AZIA1; OAZIN; ODC1L
Synonyms
AZIN1; AZIN1 cDNA Clone; AZIN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaggatttattgatgatgcaaactactccgttggcctgttggatgaaggaacaaaccttggaaatgttattgataactatgtttatgaacataccctgacagggaaaaatgcattttttgtgggagatcttggaaagattgtgaagaaacacagtcaatggcagaatgtagtggctcagataaagccattctacacagtgaagtgcaactctgctccagctgtacttgagattttggcagctcttggaaccggatttgcttgttccagtaaaaatgaaatggctttagtgcaagagttgggtgtacctccagaaaacattatttacataagtccttgcaagcaagtgtctcagataaagtatgcagcaaaagttggagtgaatatcctgacatgtgacaatgaaattgaattgaagaaaattgcacgtaatcacccaaatgccaaggtcttactacatattgcaacagaagataatattggaggtgaagagggtaacatgaagtttggcactaccctgaagaactgtaggcatctcttggaatgtgctaaggaacttgatgtccaaataattggggttaaatttcatgtttcgagtgcttgcaaagaatctcaagtatatgtacatgctctatctgatgctcgatgtgtgtttgacatggctggagaaattggctttacgatgaacatgttagacattggtggaggattcacgggaactgaatttcaattggaagaggttaatcatgttatcagccctctgttggatatctactttcctgaaggatctggtgttaagataatttcagaacccggaagctactatgtgtcttctgcatttacactcgcagttaatatcatagcaaagaaagttgttgaaaatgataaatttccctctggagtagaaaaaaccggaagtgatgaaccagccttcatgtattatatgaatgatggtgtttatggttcttttgcaagtaaactgtctgaggacttaaataccattccagaggttcacaagaaatacaaggaagatgagcctctgtttacaagcagcctttggggtccatcctgtgatgagcttgatcaaattgtggaaagctgtcttcttcctgagctgaatgtgggagattggcttatctttgataacatgggagcagattctttccatgaaccatctgcttttaatgattttcagaggccagccatttattacatgatgtcattcagtgattggtatgagatgcaagatgctggaattacttcagactcaatgatgaagaacttcttctttgtgccttcttgcattcagctgagccaagaagacagcttttccgctgaagcttaa
Sequence Length
1347
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,535 Da
NCBI Official Full Name
Homo sapiens antizyme inhibitor 1, mRNA
NCBI Official Synonym Full Names
antizyme inhibitor 1
NCBI Official Symbol
AZIN1
NCBI Official Synonym Symbols
AZI; OAZI; AZIA1; OAZIN; ODC1L
NCBI Protein Information
antizyme inhibitor 1
UniProt Protein Name
Antizyme inhibitor 1
Protein Family
UniProt Gene Name
AZIN1
UniProt Synonym Gene Names
OAZI; OAZIN; AZI
UniProt Entry Name
AZIN1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]

Uniprot Description

AZIN1: Regulates cellular polyamine homeostasis. Inhibits antizyme-dependent ornithine decarboxylase degradation by binding to antizyme. Belongs to the Orn/Lys/Arg decarboxylase class-II family. ODC antizyme inhibitor subfamily.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 8q22.3

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: ornithine decarboxylase activator activity; protein binding

Biological Process: negative regulation of protein catabolic process; putrescine biosynthetic process from ornithine; regulation of amino acid metabolic process

Research Articles on AZIN1

Similar Products

Product Notes

The AZIN1 azin1 (Catalog #AAA1271581) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaggat ttattgatga tgcaaactac tccgttggcc tgttggatga aggaacaaac cttggaaatg ttattgataa ctatgtttat gaacataccc tgacagggaa aaatgcattt tttgtgggag atcttggaaa gattgtgaag aaacacagtc aatggcagaa tgtagtggct cagataaagc cattctacac agtgaagtgc aactctgctc cagctgtact tgagattttg gcagctcttg gaaccggatt tgcttgttcc agtaaaaatg aaatggcttt agtgcaagag ttgggtgtac ctccagaaaa cattatttac ataagtcctt gcaagcaagt gtctcagata aagtatgcag caaaagttgg agtgaatatc ctgacatgtg acaatgaaat tgaattgaag aaaattgcac gtaatcaccc aaatgccaag gtcttactac atattgcaac agaagataat attggaggtg aagagggtaa catgaagttt ggcactaccc tgaagaactg taggcatctc ttggaatgtg ctaaggaact tgatgtccaa ataattgggg ttaaatttca tgtttcgagt gcttgcaaag aatctcaagt atatgtacat gctctatctg atgctcgatg tgtgtttgac atggctggag aaattggctt tacgatgaac atgttagaca ttggtggagg attcacggga actgaatttc aattggaaga ggttaatcat gttatcagcc ctctgttgga tatctacttt cctgaaggat ctggtgttaa gataatttca gaacccggaa gctactatgt gtcttctgca tttacactcg cagttaatat catagcaaag aaagttgttg aaaatgataa atttccctct ggagtagaaa aaaccggaag tgatgaacca gccttcatgt attatatgaa tgatggtgtt tatggttctt ttgcaagtaa actgtctgag gacttaaata ccattccaga ggttcacaag aaatacaagg aagatgagcc tctgtttaca agcagccttt ggggtccatc ctgtgatgag cttgatcaaa ttgtggaaag ctgtcttctt cctgagctga atgtgggaga ttggcttatc tttgataaca tgggagcaga ttctttccat gaaccatctg cttttaatga ttttcagagg ccagccattt attacatgat gtcattcagt gattggtatg agatgcaaga tgctggaatt acttcagact caatgatgaa gaacttcttc tttgtgcctt cttgcattca gctgagccaa gaagacagct tttccgctga agcttaa. It is sometimes possible for the material contained within the vial of "AZIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.