Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AXL cdna clone

AXL cDNA Clone

Gene Names
AXL; ARK; UFO; JTK11; Tyro7
Synonyms
AXL; AXL cDNA Clone; AXL cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtggcggtgccccaggatgggcagggtcccgctggcctggtgcttggcgctgtgcggctgggcgtgcatggcccccaggggcacgcaggctgaagaaagtcccttcgtgggcaacccagggaatatcacaggtgcccggggactcacgggcacccttcggtgtcagctccaggttcagggagagccccccgaggtacattggcttcgggatggacagatcctggagctcgcggacagcacccagacccaggtgcccctgggtgaggatgaacaggatgactggatagtggtcagccagctcagaatcacctccctgcagctttccgacacgggacagtaccagtgtttggtgtttctgggacatcagaccttcgtgtcccagcctggctatgttgggctggagggcttgccttacttcctggaggagcccgaagacaggactgtggccgccaacacccccttcaacctgagctgccaagctcagggacccccagagcccgtggacctactctggctccaggatgctgtccccctggccacggctccaggtcacggcccccagcgcagcctgcatgttccagggctgaacaagacatcctctttctcctgcgaagcccataacgccaagggggtcaccacatcccgcacagccaccatcacagtgctcccccagcagccccgtaacctccacctggtctcccgccaacccacggagctggaggtggcttggactccaggcctgagcggcatctaccccctgacccactgcaccctgcaggctgtgctgtcagacgatgggatgggcatccaggcgggagaaccagaccccccagaggagcccctcacctcgcaagcatccgtgcccccccatcagcttcggctaggcagcctccatcctcacaccccttatcacatccgcgtggcatgcaccagcagccagggcccctcatcctggacccactggcttcctgtggagacgccggagggagtgcccctgggcccccctgagaacattagtgctacgcggaatgggagccaggccttcgtgcattggcaagagccccgggcgcccctgcagggtaccctgttagggtaccggctggcgtatcaaggccaggacaccccagaggtgctaatggacatagggctaaggcaagaggtgaccctggagctgcagggggacgggtctgtgtccaatctgacagtgtgtgtggcagcctacactgctgctggggatggaccctggagcctcccagtacccctggaggcctggcgcccagggcaagcacagccagtccaccagctggtgaaggaaccttcaactcctgccttctcgtggccctggtggtatgtactgctaggagcagtcgtggccgctgcctgtgtcctcatcttggctctcttccttgtccaccggcgaaagaaggagacccgttatggagaagtgtttgaaccaacagtggaaagaggtgaactggtagtcaggtaccgcgtgcgcaagtcctacagtcgtcggaccactgaagctaccttgaacagcttgggcatcagtgaagagctgaaggagaagctgcgggatgtgatggtggaccggcacaaggtggccctggggaagactctgggagagggagagtttggagctgtgatggaaggccagctcaaccaggacgactccatcctcaaggtggctgtgaagacgatgaagattgccatctgcacgaggtcagagctggaggatttcctgagtgaagcggtctgcatgaaggaatttgaccatcccaacgtcatgaggctcatcggtgtctgtttccagggttctgaacgagagagcttcccagcacctgtggtcatcttacctttcatgaaacatggagacctacacagcttcctcctctattcccggctcggggaccagccagtgtacctgcccactcagatgctagtgaagttcatggcagacatcgccagtggcatggagtatctgagtaccaagagattcatacaccgggacctggcggccaggaactgcatgctgaatgagaacatgtccgtgtgtgtggcggacttcgggctctccaagaagatctacaatggggactactaccgccagggacgtatcgccaagatgccagtcaagtggattgccattgagagtctagctgaccgtgtctacaccagcaagagcgatgtgtggtccttcggggtgacaatgtgggagattgccacaagaggccaaaccccatatccgggcgtggagaacagcgagatttatgactatctgcgccggggaaatcgcctgaagcagcctgcggactgtctggatggactgtatgccttgatgtcgcggtgctgggagctaaatccccaggaccggccaagttttacagagctgcgggaagatttggagaacacactgaaggccttgcctcctgcccaggagcctgacgaaatcctctatgtcaacatggatgagggtggaggttatcctgaaccccctggagctgcaggaggagctgaccccccaacccagccagaccctaaggattcctgtagctgcctcactgcggctgaggtccatcctgctggacgctatgtcctctgcccttccacaacccctagccccgctcagcctgctgataggggctccccagcagccccagggcaggaggatggtgcctga
Sequence Length
2685
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
558
Molecular Weight
97,377 Da
NCBI Official Full Name
Homo sapiens AXL receptor tyrosine kinase, mRNA
NCBI Official Synonym Full Names
AXL receptor tyrosine kinase
NCBI Official Symbol
AXL
NCBI Official Synonym Symbols
ARK; UFO; JTK11; Tyro7
NCBI Protein Information
tyrosine-protein kinase receptor UFO
UniProt Protein Name
Tyrosine-protein kinase receptor UFO
UniProt Gene Name
AXL
UniProt Synonym Gene Names
UFO
UniProt Entry Name
UFO_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

AXL: a receptor tyrosine kinase that may function as a signal transducer between specific cell types of mesodermal origin. Interacts with SKP1. Overexpression in tissue culture causes oncogenic transformation. Overexpressed in several cancers including thyroid, ovarian, gastric, ER+ breast cancer and acute myeloid leukemia, where it is associated with poor prognosis. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Membrane protein, integral; Oncoprotein; EC 2.7.10.1; Protein kinase, TK; Protein kinase, tyrosine (receptor); TK group; Axl family

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: cell surface; extracellular space; integral to plasma membrane; plasma membrane

Molecular Function: phosphatidylserine binding; protein binding; protein-tyrosine kinase activity

Biological Process: cell maturation; entry of virus into host cell; negative regulation of interferon-gamma production; phagocytosis; positive regulation of cytokine and chemokine mediated signaling pathway; positive regulation of natural killer cell differentiation; positive regulation of pinocytosis; signal transduction; vascular endothelial growth factor receptor signaling pathway

Research Articles on AXL

Similar Products

Product Notes

The AXL axl (Catalog #AAA1269583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtggc ggtgccccag gatgggcagg gtcccgctgg cctggtgctt ggcgctgtgc ggctgggcgt gcatggcccc caggggcacg caggctgaag aaagtccctt cgtgggcaac ccagggaata tcacaggtgc ccggggactc acgggcaccc ttcggtgtca gctccaggtt cagggagagc cccccgaggt acattggctt cgggatggac agatcctgga gctcgcggac agcacccaga cccaggtgcc cctgggtgag gatgaacagg atgactggat agtggtcagc cagctcagaa tcacctccct gcagctttcc gacacgggac agtaccagtg tttggtgttt ctgggacatc agaccttcgt gtcccagcct ggctatgttg ggctggaggg cttgccttac ttcctggagg agcccgaaga caggactgtg gccgccaaca cccccttcaa cctgagctgc caagctcagg gacccccaga gcccgtggac ctactctggc tccaggatgc tgtccccctg gccacggctc caggtcacgg cccccagcgc agcctgcatg ttccagggct gaacaagaca tcctctttct cctgcgaagc ccataacgcc aagggggtca ccacatcccg cacagccacc atcacagtgc tcccccagca gccccgtaac ctccacctgg tctcccgcca acccacggag ctggaggtgg cttggactcc aggcctgagc ggcatctacc ccctgaccca ctgcaccctg caggctgtgc tgtcagacga tgggatgggc atccaggcgg gagaaccaga ccccccagag gagcccctca cctcgcaagc atccgtgccc ccccatcagc ttcggctagg cagcctccat cctcacaccc cttatcacat ccgcgtggca tgcaccagca gccagggccc ctcatcctgg acccactggc ttcctgtgga gacgccggag ggagtgcccc tgggcccccc tgagaacatt agtgctacgc ggaatgggag ccaggccttc gtgcattggc aagagccccg ggcgcccctg cagggtaccc tgttagggta ccggctggcg tatcaaggcc aggacacccc agaggtgcta atggacatag ggctaaggca agaggtgacc ctggagctgc agggggacgg gtctgtgtcc aatctgacag tgtgtgtggc agcctacact gctgctgggg atggaccctg gagcctccca gtacccctgg aggcctggcg cccagggcaa gcacagccag tccaccagct ggtgaaggaa ccttcaactc ctgccttctc gtggccctgg tggtatgtac tgctaggagc agtcgtggcc gctgcctgtg tcctcatctt ggctctcttc cttgtccacc ggcgaaagaa ggagacccgt tatggagaag tgtttgaacc aacagtggaa agaggtgaac tggtagtcag gtaccgcgtg cgcaagtcct acagtcgtcg gaccactgaa gctaccttga acagcttggg catcagtgaa gagctgaagg agaagctgcg ggatgtgatg gtggaccggc acaaggtggc cctggggaag actctgggag agggagagtt tggagctgtg atggaaggcc agctcaacca ggacgactcc atcctcaagg tggctgtgaa gacgatgaag attgccatct gcacgaggtc agagctggag gatttcctga gtgaagcggt ctgcatgaag gaatttgacc atcccaacgt catgaggctc atcggtgtct gtttccaggg ttctgaacga gagagcttcc cagcacctgt ggtcatctta cctttcatga aacatggaga cctacacagc ttcctcctct attcccggct cggggaccag ccagtgtacc tgcccactca gatgctagtg aagttcatgg cagacatcgc cagtggcatg gagtatctga gtaccaagag attcatacac cgggacctgg cggccaggaa ctgcatgctg aatgagaaca tgtccgtgtg tgtggcggac ttcgggctct ccaagaagat ctacaatggg gactactacc gccagggacg tatcgccaag atgccagtca agtggattgc cattgagagt ctagctgacc gtgtctacac cagcaagagc gatgtgtggt ccttcggggt gacaatgtgg gagattgcca caagaggcca aaccccatat ccgggcgtgg agaacagcga gatttatgac tatctgcgcc ggggaaatcg cctgaagcag cctgcggact gtctggatgg actgtatgcc ttgatgtcgc ggtgctggga gctaaatccc caggaccggc caagttttac agagctgcgg gaagatttgg agaacacact gaaggccttg cctcctgccc aggagcctga cgaaatcctc tatgtcaaca tggatgaggg tggaggttat cctgaacccc ctggagctgc aggaggagct gaccccccaa cccagccaga ccctaaggat tcctgtagct gcctcactgc ggctgaggtc catcctgctg gacgctatgt cctctgccct tccacaaccc ctagccccgc tcagcctgct gataggggct ccccagcagc cccagggcag gaggatggtg cctga. It is sometimes possible for the material contained within the vial of "AXL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.