Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATRIP cdna clone

ATRIP cDNA Clone

Synonyms
ATRIP; ATRIP cDNA Clone; ATRIP cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggacctccgcgccaggcagcaagaggcggagcgagcccccggcgcctcgccccggcccgccgccgggcaccgggcaccccccgagcaagcgggcccggggcttctccgcagccgctgccccggaccctgacgacccgttcggcgcgcatggggacttcactgccgacgacctggaggagcttgacaccctcgcgtcacaggccctgagccaatgtccggccgcggctcgggacgtgtccagtgatcataaggtccacagattattagatggcatgtcaaaaaatccttcagggaaaaacagagaaactgttccaattaaagataatttcgaattagaggtacttcaggcacaatacaaagaacttaaagaaaagatgaaagtaatggaagaagaagttctcattaagaatggagaaattaaaattttgcgagactcactacatcagacggaatccgttctagaggaacagagaagatcacattttcttcttgagcaagagaaaacccaagcactcagtgacaaggaaaaggaattctccaaaaagctccaatcattgcagtctgaactccagtttaaagatgcagagatgaatgaattaaggacaaagctccagaccagtgaacgagcaaataaactggctgctccctctgtttcccatgtcagtcctaggaaaaacccttctgtggttataaagccagaagcatgttctccacaatttggaaaaacatcttttcctacaaaggagtcttttagtgctaacatgtcccttccccacccctgccagacggagtcaggatacaagcctctggtgggcagagaggatagtaagccccacagtctgagaggtgactccataaaacaagaagaggcccagaaaagctttgttgacagctggagacagagatcaaacactcaaggttccattttgataaacctgctcctgaagcagcctttgatcccagggtcatccctaagcctttgccacctcctgagtagtagttctgagtctcctgctggcacccccctgcagccaccagggtttggcagtaccttggctggaatgtcaggcctcaggaccacaggttcttatgatgggtcattttccctctcagccctgagagaagcacagaacctggcattcactggactgaatctggttgcccggaatgagtgctcacgtgatggagacccagcagagggaggcagaagggccttcccactctgccagcttcctggagccgtgcatttcctcccccttgtacagttcttcatcggcttacactgccaggccctgcaggacttggcagctgctaagagaagcggagcacctggggactcaccgacacattcctcctgcgtgagctctggggtagagaccaaccctgaggactcagtgtgcatcctggaaggcttctctgtgactgcacttagcattcttcagcacctggtgtgccacagcggagcagtcgtctccctattactgtcaggagtgggggcagattctgctgctggggaaggaaacaggagcctggttcacaggcttagtgatggagatatgacctcagccctaaggggggttgctgatgaccaaggacagcacccactgttgaagatgcttcttcacctgttggctttctcttctgcagcaacaggtcaccttcaagccagtgtcctgacccagtgccttaaggttttggtgaaattagccgaaaacacttcctgtgatttcttgcccaggttccagtgtgtgttccaagtgctgccaaagtgcctcagcccagagacacccctgcctagcgtgctgctggctgttgagctcctctccctgctggcggaccacgaccagctggcacctcagctctgttcccactcagaaggctgcctcctgctgctgctgtacatgtacatcacatcacggcctgacagagtggccttggagacacaatggctccagctggaacaagaggtggtcagagcgctcacggtgatgttgcacagacagtggctgacagtgcggagggcagggggacccccaaggaccgaccagcagaggcggacagtgcgctgtctgcgggacacggtgctgctgctgcacggcctatcgcagaaggacaagctcttcatgatgcactgcgtggaggtcctgcatcagtttgaccaggtgatgccgggggtcagcatgctcatccgagggcttcctgatgtgacggactgtgaagaggcagccctggatgacctctgtgccgcggaaaccgatgtggaagaccccgaggtggagtgtggctga
Sequence Length
2295
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,362 Da
NCBI Official Full Name
Homo sapiens ATR interacting protein, mRNA
NCBI Official Synonym Full Names
ATR interacting protein
NCBI Official Symbol
ATRIP
NCBI Protein Information
ATR-interacting protein
UniProt Protein Name
ATR-interacting protein
Protein Family
UniProt Gene Name
ATRIP
UniProt Synonym Gene Names
AGS1
UniProt Entry Name
ATRIP_HUMAN

NCBI Description

This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

Uniprot Description

ATRIP: is required for checkpoint signaling after DNA damage. Required for ATR expression, possibly by stabilizing the protein. Heterodimerizes with ATR. The heterodimer binds replication protein A (RPA), a protein complex that subsequently is recruited to single stranded DNA (ssDNA). Its EEXXXDDL motif is required for the interaction with catalytic subunit of DNA-PK and its recruitment to sites of DNA damage. e for this protein is either identical to or adjacent to that of ATRIP. Some of the mRNAs that encode ATRIP also encode TREX1 in another reading frame. Three alternatively spliced human isoforms have been reported.

Protein type: DNA-binding; Cell cycle regulation; DNA repair, damage

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: DNA damage checkpoint; DNA replication

Research Articles on ATRIP

Similar Products

Product Notes

The ATRIP atrip (Catalog #AAA1275525) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggga cctccgcgcc aggcagcaag aggcggagcg agcccccggc gcctcgcccc ggcccgccgc cgggcaccgg gcaccccccg agcaagcggg cccggggctt ctccgcagcc gctgccccgg accctgacga cccgttcggc gcgcatgggg acttcactgc cgacgacctg gaggagcttg acaccctcgc gtcacaggcc ctgagccaat gtccggccgc ggctcgggac gtgtccagtg atcataaggt ccacagatta ttagatggca tgtcaaaaaa tccttcaggg aaaaacagag aaactgttcc aattaaagat aatttcgaat tagaggtact tcaggcacaa tacaaagaac ttaaagaaaa gatgaaagta atggaagaag aagttctcat taagaatgga gaaattaaaa ttttgcgaga ctcactacat cagacggaat ccgttctaga ggaacagaga agatcacatt ttcttcttga gcaagagaaa acccaagcac tcagtgacaa ggaaaaggaa ttctccaaaa agctccaatc attgcagtct gaactccagt ttaaagatgc agagatgaat gaattaagga caaagctcca gaccagtgaa cgagcaaata aactggctgc tccctctgtt tcccatgtca gtcctaggaa aaacccttct gtggttataa agccagaagc atgttctcca caatttggaa aaacatcttt tcctacaaag gagtctttta gtgctaacat gtcccttccc cacccctgcc agacggagtc aggatacaag cctctggtgg gcagagagga tagtaagccc cacagtctga gaggtgactc cataaaacaa gaagaggccc agaaaagctt tgttgacagc tggagacaga gatcaaacac tcaaggttcc attttgataa acctgctcct gaagcagcct ttgatcccag ggtcatccct aagcctttgc cacctcctga gtagtagttc tgagtctcct gctggcaccc ccctgcagcc accagggttt ggcagtacct tggctggaat gtcaggcctc aggaccacag gttcttatga tgggtcattt tccctctcag ccctgagaga agcacagaac ctggcattca ctggactgaa tctggttgcc cggaatgagt gctcacgtga tggagaccca gcagagggag gcagaagggc cttcccactc tgccagcttc ctggagccgt gcatttcctc ccccttgtac agttcttcat cggcttacac tgccaggccc tgcaggactt ggcagctgct aagagaagcg gagcacctgg ggactcaccg acacattcct cctgcgtgag ctctggggta gagaccaacc ctgaggactc agtgtgcatc ctggaaggct tctctgtgac tgcacttagc attcttcagc acctggtgtg ccacagcgga gcagtcgtct ccctattact gtcaggagtg ggggcagatt ctgctgctgg ggaaggaaac aggagcctgg ttcacaggct tagtgatgga gatatgacct cagccctaag gggggttgct gatgaccaag gacagcaccc actgttgaag atgcttcttc acctgttggc tttctcttct gcagcaacag gtcaccttca agccagtgtc ctgacccagt gccttaaggt tttggtgaaa ttagccgaaa acacttcctg tgatttcttg cccaggttcc agtgtgtgtt ccaagtgctg ccaaagtgcc tcagcccaga gacacccctg cctagcgtgc tgctggctgt tgagctcctc tccctgctgg cggaccacga ccagctggca cctcagctct gttcccactc agaaggctgc ctcctgctgc tgctgtacat gtacatcaca tcacggcctg acagagtggc cttggagaca caatggctcc agctggaaca agaggtggtc agagcgctca cggtgatgtt gcacagacag tggctgacag tgcggagggc agggggaccc ccaaggaccg accagcagag gcggacagtg cgctgtctgc gggacacggt gctgctgctg cacggcctat cgcagaagga caagctcttc atgatgcact gcgtggaggt cctgcatcag tttgaccagg tgatgccggg ggtcagcatg ctcatccgag ggcttcctga tgtgacggac tgtgaagagg cagccctgga tgacctctgt gccgcggaaa ccgatgtgga agaccccgag gtggagtgtg gctga. It is sometimes possible for the material contained within the vial of "ATRIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.