Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATRIP cdna clone

ATRIP cDNA Clone

Synonyms
ATRIP; ATRIP cDNA Clone; ATRIP cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaaaaatccttcagggaaaaacagagaaactgttccaattaaagataatttcgaattagaggtacttcaggcacaatacaaagaacttaaagaaaagatgaaagtaatggaagaagaagttctcattaagaatggagaaattaaaattttgcgagactcactacatcagacggaatccgttctagaggaacagagaagatcacattttcttcttgagcaagagaaaacccaagcactcagtgacaaggaaaaggaattctccaaaaagctccaatcattgcagtctgaactccagtttaaagatgcagagatgaatgaattaaggacaaagctccagaccagtgaacgagcaaataaactggctgctccctctgtttcccatgtcagtcctaggaaaaacccttctgtggttataaagccagaagcatgttctccacaatttggaaaaacatcttttcctacaaaggagtcttttagtgctaacatgtcccttccccacccctgccagacggagtcaggatacaagcctctggtgggcagagaggatagtaagccccacagtctgagaggtgactccataaaacaagaagaggcccagaaaagctttgttgacagctggagacagagatcaaacactcaaggttccattttgataaacctgctcctgaagcagcctttgatcccagggtcatccctaagcctttgccacctcctgagtagtagttctgagtctcctgctggcacccccctgcagccaccagggtttggcagtaccttggctggaatgtcaggcctcaggaccacaggttcttatgatgggtcattttccctctcagccctgagagaagcacagaacctggcattcactggactgaatctggttgcccggaatgagtgctcacgtgatggagacccagcagagggaggcagaagggccttcccactctgccagcttcctggagccgtgcatttcctcccccttgtacagttcttcatcggcttacactgccaggccctgcaggacttggcagctgctaagagaagcggagcacctggggactcaccgacacattcctcctgcgtgagctctggggtagagaccaaccctgaggactcagtgtgcatcctggaaggcttctctgtgactgcacttagcattcttcagcacctggtgtgccacagcggagcagtcgtctccctattactgtcaggagtgggggcagattctgctgctggggaaggaaacaggagcctggttcacaggcttagtgatggagatatgacctcagccctaaggggggttgctgatgaccaaggacagcacccactgttgaagatgcttcttcacctgttggctttctcttctgcagcaacaggtcaccttcaagccagtgtcctgacccagtgccttaaggttttggtgaaattagccgaaaacacttcctgtgatttcttgcccaggttccagtgtgtgttccaagtgctgccaaagtgcctcagcccagagacacccctgcctagcgtgctgctggctgttgagctcctctccctgctggcggaccacgaccagctggcacctcagctctgttcccactcagaaggctgcctcctgctgctgctgtacatgtacatcacatcacggcctgacagagtggccttggagacacaatggctccagctggaacaagaggtggtgtggctcctggctaagcttggtgtgcagagccccttgcccccagtcactggctccaactgccagtgtaatgtggaggtaatcagagcgctcacggtgatgttgcacagacagtggctgacagtgcggagggcagggggacccccaaggaccgaccagcagaggcggacagtgcgctgtctgcgggacacggtgctgctgctgcacggcctatcgcagaaggacaagctcttcatgatgcactgcgtggaggtcctgcatcagtttgaccaggtgatgccgggggtcagcatgctcatccgagggcttcctgatgtgacggactgtgaagaggcagccctggatgacctctgtgccgcggaaaccgatgtggaagaccccgaggtggagtgtggctga
Sequence Length
2097
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,362 Da
NCBI Official Full Name
Homo sapiens ATR interacting protein, mRNA
NCBI Official Synonym Full Names
ATR interacting protein
NCBI Official Symbol
ATRIP
NCBI Protein Information
ATR-interacting protein
UniProt Protein Name
ATR-interacting protein
Protein Family
UniProt Gene Name
ATRIP
UniProt Synonym Gene Names
AGS1
UniProt Entry Name
ATRIP_HUMAN

NCBI Description

This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

Uniprot Description

ATRIP: is required for checkpoint signaling after DNA damage. Required for ATR expression, possibly by stabilizing the protein. Heterodimerizes with ATR. The heterodimer binds replication protein A (RPA), a protein complex that subsequently is recruited to single stranded DNA (ssDNA). Its EEXXXDDL motif is required for the interaction with catalytic subunit of DNA-PK and its recruitment to sites of DNA damage. e for this protein is either identical to or adjacent to that of ATRIP. Some of the mRNAs that encode ATRIP also encode TREX1 in another reading frame. Three alternatively spliced human isoforms have been reported.

Protein type: DNA repair, damage; DNA-binding; Cell cycle regulation

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: DNA damage checkpoint; DNA replication

Research Articles on ATRIP

Similar Products

Product Notes

The ATRIP atrip (Catalog #AAA1268916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaaaa atccttcagg gaaaaacaga gaaactgttc caattaaaga taatttcgaa ttagaggtac ttcaggcaca atacaaagaa cttaaagaaa agatgaaagt aatggaagaa gaagttctca ttaagaatgg agaaattaaa attttgcgag actcactaca tcagacggaa tccgttctag aggaacagag aagatcacat tttcttcttg agcaagagaa aacccaagca ctcagtgaca aggaaaagga attctccaaa aagctccaat cattgcagtc tgaactccag tttaaagatg cagagatgaa tgaattaagg acaaagctcc agaccagtga acgagcaaat aaactggctg ctccctctgt ttcccatgtc agtcctagga aaaacccttc tgtggttata aagccagaag catgttctcc acaatttgga aaaacatctt ttcctacaaa ggagtctttt agtgctaaca tgtcccttcc ccacccctgc cagacggagt caggatacaa gcctctggtg ggcagagagg atagtaagcc ccacagtctg agaggtgact ccataaaaca agaagaggcc cagaaaagct ttgttgacag ctggagacag agatcaaaca ctcaaggttc cattttgata aacctgctcc tgaagcagcc tttgatccca gggtcatccc taagcctttg ccacctcctg agtagtagtt ctgagtctcc tgctggcacc cccctgcagc caccagggtt tggcagtacc ttggctggaa tgtcaggcct caggaccaca ggttcttatg atgggtcatt ttccctctca gccctgagag aagcacagaa cctggcattc actggactga atctggttgc ccggaatgag tgctcacgtg atggagaccc agcagaggga ggcagaaggg ccttcccact ctgccagctt cctggagccg tgcatttcct cccccttgta cagttcttca tcggcttaca ctgccaggcc ctgcaggact tggcagctgc taagagaagc ggagcacctg gggactcacc gacacattcc tcctgcgtga gctctggggt agagaccaac cctgaggact cagtgtgcat cctggaaggc ttctctgtga ctgcacttag cattcttcag cacctggtgt gccacagcgg agcagtcgtc tccctattac tgtcaggagt gggggcagat tctgctgctg gggaaggaaa caggagcctg gttcacaggc ttagtgatgg agatatgacc tcagccctaa ggggggttgc tgatgaccaa ggacagcacc cactgttgaa gatgcttctt cacctgttgg ctttctcttc tgcagcaaca ggtcaccttc aagccagtgt cctgacccag tgccttaagg ttttggtgaa attagccgaa aacacttcct gtgatttctt gcccaggttc cagtgtgtgt tccaagtgct gccaaagtgc ctcagcccag agacacccct gcctagcgtg ctgctggctg ttgagctcct ctccctgctg gcggaccacg accagctggc acctcagctc tgttcccact cagaaggctg cctcctgctg ctgctgtaca tgtacatcac atcacggcct gacagagtgg ccttggagac acaatggctc cagctggaac aagaggtggt gtggctcctg gctaagcttg gtgtgcagag ccccttgccc ccagtcactg gctccaactg ccagtgtaat gtggaggtaa tcagagcgct cacggtgatg ttgcacagac agtggctgac agtgcggagg gcagggggac ccccaaggac cgaccagcag aggcggacag tgcgctgtct gcgggacacg gtgctgctgc tgcacggcct atcgcagaag gacaagctct tcatgatgca ctgcgtggag gtcctgcatc agtttgacca ggtgatgccg ggggtcagca tgctcatccg agggcttcct gatgtgacgg actgtgaaga ggcagccctg gatgacctct gtgccgcgga aaccgatgtg gaagaccccg aggtggagtg tggctga. It is sometimes possible for the material contained within the vial of "ATRIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.