ATL3 cdna clone
ATL3 cDNA Clone
Gene Names
ATL3; HSN1F
Synonyms
ATL3; ATL3 cDNA Clone; ATL3 cdna clone
Sequence
atgttgtcccctcagcgagtggcagcagctgcctcaagaggagcagatgatgccatggagagcagcaagcctggtccagtgcaggttgttttggttcagaaagatcaacattcctttgagctagatgagaaagccttggccagcatcctcttgcaggaccacatccgagatcttgatgtggtggtggtttcagtggctggtgccttccgaaagggcaagtccttcattctggattttatgctacgatacttatattctcagaaggaaagtggccattcaaattggttgggtgacccagaagaaccgttaacaggattttcctggagagggggatctgatccagaaaccactgggattcaaatctggagtgaagttttcactgtggagaagccaggtgggaagaaggttgcagttgttctgatggatacccagggggcatttgacagccagtcaactgtgaaagactgtgctaccatctttgctctaagcactatgactagttctgttcagatttataatttatctcagaacattcaagaagatgatcttcaacagctgcagctcttcacagaatacggtcgtctggcaatggatgaaattttccaaaagcctttccagacactgatgtttttggttagagattggagtttcccttatgaatatagctatggactccaaggaggaatggcatttttggataagcgtttacaggtgaaggaacatcaacatgaagaaattcagaatgttcgaaatcacattcactcatgtttctccgatgtcacctgctttctcttaccacatccaggactccaggtggccacaagccctgactttgatgggaaattaaaagatattgctggtgaattcaaagagcagttacaggcactgataccgtatgtattaaacccatctaagttaatggaaaaggagatcaatggctcaaaggtcacctgtcggggactactggagtattttaaggcatatattaaaatttatcaaggagaagatctgcctcaccccaagtccatgcttcaggccactgctgaagccaacaacttagcagctgcagcctctgccaaggacatttattataacaacatggaagaggtttgtgggggagagaaaccttatttgtctccagacattctagaggagaagcactgtgaattcaaacaacttgctctggaccattttaagaagaccaagaagatgggtgggaaggatttcagctttcgttaccagcaggagctggaggaggaaatcaaggaattatatgagaacttctgcaagcacaatggtagcaagaacgtcttcagcaccttccgaacccctgcagtgctgttcacgggcattgtagctttgtacatagcctcaggcctcactggcttcataggtcttgaggttgtagcccagttgttcaactgtatggttggactactgttaatagcactcctcacctggggctacatcaggtattctggtcaatatcgtgagctgggcggagctattgattttggtgccgcatatgtgttggagcaggcttcttctcatatcggtaattccactcaggccactgtgagggatgcagttgttggaagaccatccatggataaaaaagctcaatag
Sequence Length
1626
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,542 Da
NCBI Official Full Name
Homo sapiens atlastin GTPase 3, mRNA
NCBI Official Synonym Full Names
atlastin GTPase 3
NCBI Official Symbol
ATL3
NCBI Official Synonym Symbols
HSN1F
NCBI Protein Information
atlastin-3
UniProt Protein Name
Atlastin-3
Protein Family
UniProt Gene Name
ATL3
UniProt Entry Name
ATLA3_HUMAN
NCBI Description
This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]
Uniprot Description
ATL3: GTPase tethering membranes through formation of trans- homooligomer and mediating homotypic fusion of endoplasmic reticulum membranes. Functions in endoplasmic reticulum tubular network biogenesis. Belongs to the GBP family. Atlastin subfamily.
Protein type: EC 3.6.5.-; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 11q13.1
Cellular Component: endoplasmic reticulum; integral to membrane; membrane
Molecular Function: identical protein binding
Biological Process: endoplasmic reticulum organization and biogenesis; ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; protein homooligomerization
Disease: Neuropathy, Hereditary Sensory, Type If
Research Articles on ATL3
Similar Products
Product Notes
The ATL3 atl3 (Catalog #AAA1267498) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgtccc ctcagcgagt ggcagcagct gcctcaagag gagcagatga tgccatggag agcagcaagc ctggtccagt gcaggttgtt ttggttcaga aagatcaaca ttcctttgag ctagatgaga aagccttggc cagcatcctc ttgcaggacc acatccgaga tcttgatgtg gtggtggttt cagtggctgg tgccttccga aagggcaagt ccttcattct ggattttatg ctacgatact tatattctca gaaggaaagt ggccattcaa attggttggg tgacccagaa gaaccgttaa caggattttc ctggagaggg ggatctgatc cagaaaccac tgggattcaa atctggagtg aagttttcac tgtggagaag ccaggtggga agaaggttgc agttgttctg atggataccc agggggcatt tgacagccag tcaactgtga aagactgtgc taccatcttt gctctaagca ctatgactag ttctgttcag atttataatt tatctcagaa cattcaagaa gatgatcttc aacagctgca gctcttcaca gaatacggtc gtctggcaat ggatgaaatt ttccaaaagc ctttccagac actgatgttt ttggttagag attggagttt cccttatgaa tatagctatg gactccaagg aggaatggca tttttggata agcgtttaca ggtgaaggaa catcaacatg aagaaattca gaatgttcga aatcacattc actcatgttt ctccgatgtc acctgctttc tcttaccaca tccaggactc caggtggcca caagccctga ctttgatggg aaattaaaag atattgctgg tgaattcaaa gagcagttac aggcactgat accgtatgta ttaaacccat ctaagttaat ggaaaaggag atcaatggct caaaggtcac ctgtcgggga ctactggagt attttaaggc atatattaaa atttatcaag gagaagatct gcctcacccc aagtccatgc ttcaggccac tgctgaagcc aacaacttag cagctgcagc ctctgccaag gacatttatt ataacaacat ggaagaggtt tgtgggggag agaaacctta tttgtctcca gacattctag aggagaagca ctgtgaattc aaacaacttg ctctggacca ttttaagaag accaagaaga tgggtgggaa ggatttcagc tttcgttacc agcaggagct ggaggaggaa atcaaggaat tatatgagaa cttctgcaag cacaatggta gcaagaacgt cttcagcacc ttccgaaccc ctgcagtgct gttcacgggc attgtagctt tgtacatagc ctcaggcctc actggcttca taggtcttga ggttgtagcc cagttgttca actgtatggt tggactactg ttaatagcac tcctcacctg gggctacatc aggtattctg gtcaatatcg tgagctgggc ggagctattg attttggtgc cgcatatgtg ttggagcagg cttcttctca tatcggtaat tccactcagg ccactgtgag ggatgcagtt gttggaagac catccatgga taaaaaagct caatag. It is sometimes possible for the material contained within the vial of "ATL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
