Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATIC cdna clone

ATIC cDNA Clone

Gene Names
ATIC; PURH; AICAR; AICARFT; IMPCHASE; HEL-S-70p
Synonyms
ATIC; ATIC cDNA Clone; ATIC cdna clone
Ordering
For Research Use Only!
Sequence
atggctcccggccagctcgccttatttagtgtctctgacaaaaccggccttgtggaatttgcaagaaacctgaccgctcttggtttgaatctggtcgcttccggagggactgcaaaagctctcagggatgctggtctggcagtcagagatgtctctgagttgacgggatttcctgaaatgttggggggacgtgtgaaaactttgcatcctgcagtccatgctggaatcctagctcgtaatattccagaagataatgctgacatggccagacttgatttcaatcttataagagttgttgcctgcaatctctatccctttgtaaagacagtggcttctccaggtgtaactgttgaggaggctgtggagcaaattgacattggtggagtaaccttactgagagctgcagccaaaaaccacgctcgagtgacagtggtgtgtgaaccagaggactatgtggtggtgtccacggagatgcagagctccgagagtaaggacacctccttggagactagacgccagttagccttgaaggcattcactcatacggcacaatatgatgaagcaatttcagattatttcaggaaacagtacagcaaaggcgtatctcagatgcccttgagatatggaatgaacccacatcagacccctgcccagctgtacacactgcagcccaagcttcccatcacagttctaaatggagcccctggatttataaacttgtgcgatgctttgaacgcctggcagctggtgaaggaactcaaggaggctttaggtattccagccgctgcctctttcaaacatgtcagcccagcaggtgctgctgttggaattccactcagtgaagatgaggccaaagtctgcatggtttatgatctctataaaaccctcacacccatctcagcggcatatgcaagagcaagaggggctgataggatgtcttcatttggtgattttgttgcattgtccgatgtttgtgatgtaccaactgcaaaaattatttccagagaagtatctgatggtataattgccccaggatatgaagaagaagccttgacaatactttccaaaaagaaaaatggaaactattgtgtccttcagatggaccaatcttacaaaccagatgaaaatgaagttcgaactctctttggtcttcatttaagccagaagagaaataatggtgtcgtcgacaagtcattatttagcaatgttgttaccaaaaataaagatttgccagagtctgccctccgagacctcatcgtagccaccattgctgtcaagtacactcagtctaactctgtgtgctacgccaagaacgggcaggttatcggcattggagcaggacagcagtctcgtatacactgcactcgccttgcaggagataaggcaaactattggtggcttagacaccatccacaagtgctttcgatgaagtttaaaacaggagtgaagagagcagaaatctccaatgccatcgatcaatatgtgactggaaccattggcgaggatgaagatttgataaagtggaaggcactgtttgaggaagtccctgagttactcactgaggcagagaagaaggaatgggttgagaaactgactgaagtttctatcagctctgatgccttcttccctttccgagataacgtagacagagctaaaaggagtggtgtggcgtacattgcggctccctccggttctgctgctgacaaagttgtgattgaggcctgcgacgaactgggaatcatcctcgctcatacgaaccttcggctcttccaccactga
Sequence Length
1779
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
471
Molecular Weight
64,524 Da
NCBI Official Full Name
Homo sapiens 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase, mRNA
NCBI Official Synonym Full Names
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
NCBI Official Symbol
ATIC
NCBI Official Synonym Symbols
PURH; AICAR; AICARFT; IMPCHASE; HEL-S-70p
NCBI Protein Information
bifunctional purine biosynthesis protein PURH
UniProt Protein Name
Bifunctional purine biosynthesis protein PURH
UniProt Gene Name
ATIC
UniProt Synonym Gene Names
PURH
UniProt Entry Name
PUR9_HUMAN

NCBI Description

This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]

Uniprot Description

ATIC: Bifunctional enzyme that catalyzes 2 steps in purine biosynthesis. Defects in ATIC are the cause of AICAR transformylase/IMP cyclohydrolase deficiency (AICAR). A neurologically devastating inborn error of purine biosynthesis. Patients excrete massive amounts of AICA-riboside in the urine and accumulate AICA- ribotide and its derivatives in erythrocytes and fibroblasts. AICAR causes profound mental retardation, epilepsy, dysmorphic features and congenital blindness. Belongs to the PurH family.

Protein type: Nucleotide Metabolism - purine; Cofactor and Vitamin Metabolism - one carbon pool by folate; EC 2.1.2.3; Hydrolase; EC 3.5.4.10; Mitochondrial; Methyltransferase

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: cell-cell adherens junction; cytosol; membrane

Molecular Function: IMP cyclohydrolase activity; phosphoribosylaminoimidazolecarboxamide formyltransferase activity; protein homodimerization activity

Biological Process: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; purine ribonucleoside monophosphate biosynthetic process

Disease: Aicar Transformylase/imp Cyclohydrolase Deficiency

Research Articles on ATIC

Similar Products

Product Notes

The ATIC atic (Catalog #AAA1273407) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcccg gccagctcgc cttatttagt gtctctgaca aaaccggcct tgtggaattt gcaagaaacc tgaccgctct tggtttgaat ctggtcgctt ccggagggac tgcaaaagct ctcagggatg ctggtctggc agtcagagat gtctctgagt tgacgggatt tcctgaaatg ttggggggac gtgtgaaaac tttgcatcct gcagtccatg ctggaatcct agctcgtaat attccagaag ataatgctga catggccaga cttgatttca atcttataag agttgttgcc tgcaatctct atccctttgt aaagacagtg gcttctccag gtgtaactgt tgaggaggct gtggagcaaa ttgacattgg tggagtaacc ttactgagag ctgcagccaa aaaccacgct cgagtgacag tggtgtgtga accagaggac tatgtggtgg tgtccacgga gatgcagagc tccgagagta aggacacctc cttggagact agacgccagt tagccttgaa ggcattcact catacggcac aatatgatga agcaatttca gattatttca ggaaacagta cagcaaaggc gtatctcaga tgcccttgag atatggaatg aacccacatc agacccctgc ccagctgtac acactgcagc ccaagcttcc catcacagtt ctaaatggag cccctggatt tataaacttg tgcgatgctt tgaacgcctg gcagctggtg aaggaactca aggaggcttt aggtattcca gccgctgcct ctttcaaaca tgtcagccca gcaggtgctg ctgttggaat tccactcagt gaagatgagg ccaaagtctg catggtttat gatctctata aaaccctcac acccatctca gcggcatatg caagagcaag aggggctgat aggatgtctt catttggtga ttttgttgca ttgtccgatg tttgtgatgt accaactgca aaaattattt ccagagaagt atctgatggt ataattgccc caggatatga agaagaagcc ttgacaatac tttccaaaaa gaaaaatgga aactattgtg tccttcagat ggaccaatct tacaaaccag atgaaaatga agttcgaact ctctttggtc ttcatttaag ccagaagaga aataatggtg tcgtcgacaa gtcattattt agcaatgttg ttaccaaaaa taaagatttg ccagagtctg ccctccgaga cctcatcgta gccaccattg ctgtcaagta cactcagtct aactctgtgt gctacgccaa gaacgggcag gttatcggca ttggagcagg acagcagtct cgtatacact gcactcgcct tgcaggagat aaggcaaact attggtggct tagacaccat ccacaagtgc tttcgatgaa gtttaaaaca ggagtgaaga gagcagaaat ctccaatgcc atcgatcaat atgtgactgg aaccattggc gaggatgaag atttgataaa gtggaaggca ctgtttgagg aagtccctga gttactcact gaggcagaga agaaggaatg ggttgagaaa ctgactgaag tttctatcag ctctgatgcc ttcttccctt tccgagataa cgtagacaga gctaaaagga gtggtgtggc gtacattgcg gctccctccg gttctgctgc tgacaaagtt gtgattgagg cctgcgacga actgggaatc atcctcgctc atacgaacct tcggctcttc caccactga. It is sometimes possible for the material contained within the vial of "ATIC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.