Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATG7 cdna clone

ATG7 cDNA Clone

Gene Names
ATG7; GSA7; APG7L; APG7-LIKE
Synonyms
ATG7; ATG7 cDNA Clone; ATG7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcagctacgggggatcctggactctctaaactgcagtttgccccttttagtagtgccttggatgttgggttttggcatgagttgacccagaagaagctgaacgagtatcggctggatgaagctcccaaggacattaagggttattactacaatggtgactctgctgggctgccagctcgcttaacattggagttcagtgcttttgacatgagtgctcccaccccagcccgttgctgcccagctattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgagatatgggaatccataaaatcaggcactgctcttgaaaaccctgtactcctcaacaagttcctcctcttgacatttgcagatctaaagaagtaccacttctactattggttttgctatcctgccctctgtcttccagagagtttacctctcattcaggggccagtgggtttggatcaaaggttttcactaaaacagattgaagcactagagtgtgcatatgataatctttgtcaaacagaaggagtcacagctcttccttacttcttaatcaagtatgatgagaacatggtgctggtttccttgcttaaacactacagtgatttcttccaaggtcaaaggacgaagataacaattggtgtatatgatccctgtaacttagcccagtaccctggatggcctttgaggaattttttggtcctagcagcccacagatggagtagcagtttccagtctgttgaagttgtttgcttccgtgaccgtaccatgcagggggcgagagacgttgcccacagcatcatcttcgaagtgaagcttccagaaatggcatttagcccagattgtcctaaagcagttggatgggaaaagaaccagaaaggaggcatgggaccaaggatggtgaacctcagtgaatgtatggaccctaaaaggttagctgagtcatcagtggatctaaatctcaaactgatgtgttggagattggttcctactttagacttggacaaggttgtgtctgtcaaatgtctgctgcttggagccggcaccttgggttgcaatgtagctaggacgttgatgggttggggcgtgagacacatcacatttgtggacaatgccaagatctcctactccaatcctgtgaggcagcctctctatgagtttgaagattgcctagggggtggtaagcccaaggctctggcagcagcggaccggctccagaaaatattccccggtgtgaatgccagaggattcaacatgagcatacctatgcctgggcatccagtgaacttctccagtgtcactctggagcaagcccgcagagatgtggagcaactggagcagctcatcgaaagccatgatgtcgtcttcctattgatggacaccagggagagccggtggcttcctgccgtcattgctgcaagcaagagaaagctggtcatcaatgctgctttgggatttgacacatttgttgtcatgagacatggtctgaagaaaccaaagcagcaaggagctggggacttgtgtccaaaccaccctgtggcatctgctgacctcctgggctcatcgctttttgccaacatccctggttacaagcttggctgctacttctgcaatgatgtggtggccccaggagattcaaccagagaccggaccttggaccagcagtgcactgtgagtcgtccaggactggccgtgattgcaggagccctggccgtggaattgatggtatctgttttgcagcatccagaagggggctatgccattgccagcagcagtgacgatcggatgaatgagcctccaacctctcttgggcttgtgcctcaccaggttcttgatcaatatgaacgagaaggatttaacttcctagccaaggtgtttaattcttcacattccttcttagaagacttgactggtcttacattgctgcatcaagaaacccaagctgctgagatctgggacatgagcgatgatgagaccatctga
Sequence Length
2031
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,618 Da
NCBI Official Full Name
Homo sapiens ATG7 autophagy related 7 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 7
NCBI Official Symbol
ATG7
NCBI Official Synonym Symbols
GSA7; APG7L; APG7-LIKE
NCBI Protein Information
ubiquitin-like modifier-activating enzyme ATG7
UniProt Protein Name
Ubiquitin-like modifier-activating enzyme ATG7
UniProt Gene Name
ATG7
UniProt Synonym Gene Names
APG7L; APG7-like; hAGP7
UniProt Entry Name
ATG7_HUMAN

NCBI Description

This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

ATG7: Functions as an E1 enzyme essential for multisubstrates such as ATG8-like proteins and ATG12. Forms intermediate conjugates with ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). PE-conjugation to ATG8-like proteins is essential for autophagy. Also acts as an E1 enzyme for ATG12 conjugation to ATG5 and ATG3. Homodimer. Interacts with ATG3 and ATG12. The complex, composed of ATG3 and ATG7, plays a role in the conjugation of ATG12 to ATG5. Widely expressed, especially in kidney, liver, lymph nodes and bone marrow. Belongs to the ATG7 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Autophagy; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 3p25.3

Cellular Component: axoneme; cytoplasm; cytosol

Molecular Function: APG12 activating enzyme activity; APG8 activating enzyme activity; protein binding; protein homodimerization activity; transcription factor binding; ubiquitin activating enzyme activity

Biological Process: autophagy; C-terminal protein lipidation; cellular response to nitrogen starvation; cellular response to starvation; defense response to virus; macroautophagy; positive regulation of apoptosis; positive regulation of autophagy; positive regulation of macroautophagy; positive regulation of protein catabolic process; positive regulation of protein modification process; protein amino acid lipidation; protein modification process

Research Articles on ATG7

Similar Products

Product Notes

The ATG7 atg7 (Catalog #AAA1274679) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcag ctacggggga tcctggactc tctaaactgc agtttgcccc ttttagtagt gccttggatg ttgggttttg gcatgagttg acccagaaga agctgaacga gtatcggctg gatgaagctc ccaaggacat taagggttat tactacaatg gtgactctgc tgggctgcca gctcgcttaa cattggagtt cagtgctttt gacatgagtg ctcccacccc agcccgttgc tgcccagcta ttggaacact gtataacacc aacacactcg agtctttcaa gactgcagat aagaagctcc ttttggaaca agcagcaaat gagatatggg aatccataaa atcaggcact gctcttgaaa accctgtact cctcaacaag ttcctcctct tgacatttgc agatctaaag aagtaccact tctactattg gttttgctat cctgccctct gtcttccaga gagtttacct ctcattcagg ggccagtggg tttggatcaa aggttttcac taaaacagat tgaagcacta gagtgtgcat atgataatct ttgtcaaaca gaaggagtca cagctcttcc ttacttctta atcaagtatg atgagaacat ggtgctggtt tccttgctta aacactacag tgatttcttc caaggtcaaa ggacgaagat aacaattggt gtatatgatc cctgtaactt agcccagtac cctggatggc ctttgaggaa ttttttggtc ctagcagccc acagatggag tagcagtttc cagtctgttg aagttgtttg cttccgtgac cgtaccatgc agggggcgag agacgttgcc cacagcatca tcttcgaagt gaagcttcca gaaatggcat ttagcccaga ttgtcctaaa gcagttggat gggaaaagaa ccagaaagga ggcatgggac caaggatggt gaacctcagt gaatgtatgg accctaaaag gttagctgag tcatcagtgg atctaaatct caaactgatg tgttggagat tggttcctac tttagacttg gacaaggttg tgtctgtcaa atgtctgctg cttggagccg gcaccttggg ttgcaatgta gctaggacgt tgatgggttg gggcgtgaga cacatcacat ttgtggacaa tgccaagatc tcctactcca atcctgtgag gcagcctctc tatgagtttg aagattgcct agggggtggt aagcccaagg ctctggcagc agcggaccgg ctccagaaaa tattccccgg tgtgaatgcc agaggattca acatgagcat acctatgcct gggcatccag tgaacttctc cagtgtcact ctggagcaag cccgcagaga tgtggagcaa ctggagcagc tcatcgaaag ccatgatgtc gtcttcctat tgatggacac cagggagagc cggtggcttc ctgccgtcat tgctgcaagc aagagaaagc tggtcatcaa tgctgctttg ggatttgaca catttgttgt catgagacat ggtctgaaga aaccaaagca gcaaggagct ggggacttgt gtccaaacca ccctgtggca tctgctgacc tcctgggctc atcgcttttt gccaacatcc ctggttacaa gcttggctgc tacttctgca atgatgtggt ggccccagga gattcaacca gagaccggac cttggaccag cagtgcactg tgagtcgtcc aggactggcc gtgattgcag gagccctggc cgtggaattg atggtatctg ttttgcagca tccagaaggg ggctatgcca ttgccagcag cagtgacgat cggatgaatg agcctccaac ctctcttggg cttgtgcctc accaggttct tgatcaatat gaacgagaag gatttaactt cctagccaag gtgtttaatt cttcacattc cttcttagaa gacttgactg gtcttacatt gctgcatcaa gaaacccaag ctgctgagat ctgggacatg agcgatgatg agaccatctg a. It is sometimes possible for the material contained within the vial of "ATG7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.