ATG5 cdna clone

ATG5 cDNA Clone

Cat. Num. AAA1276455

• Gene Names: ATG5; ASP; APG5; APG5L; hAPG5; APG5-LIKE
• Synonyms: ATG5; ATG5 cDNA Clone; ATG5 cdna clone

• Sequence: atgacagatgacaaagatgtgcttcgagatgtgtggtttggacgaattccaacttgtttcacgctatatcaggatgagataactgaaagggaagcagaaccatactatttgcttttgccaagagtaagttatttgacgttggtaactgacaaagtgaaaaagcactttcagaaggttatgagacaagaagacattagtgagatatggtttgaatatgaaggcacaccactgaaatggcattatccaattggtttgctatttgatcttcttgcatcaagttcagctcttccttggaacatcacagtacattttaagagttttccagaaaaagaccttctgcactgtccatctaaggatgcaattgaagctcattttatgtcatgtatgaaagaagctgatgctttaaaacataaaagtcaagtaatcaatgaaatgcagaaaaaagatcacaagcaactctggatgggattgcaaaatgacagatttgaccagttttgggccatcaatcggaaactcatggaatatcctgcagaagaaaatggatttcgttatatcccctttagaatatatcagacaacgactgaaagacctttcattcagaagctgtttcgtcctgtggctgcagatggacagttgcacacactaggagatctcctcaaagaagtttgtccttctgctattgatcctgaagatggggaaaaaaagaatcaagtgatgattcatggaattgagccaatgttggaaacacctctgcagtggctgagtgaacatctgagctacccggataattttcttcatattagtatcatcccacagccaacagattga
• Sequence Length: 828

• Vector: pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 33877035
• NCBI GeneID: 9474
• Molecular Weight: 22,931 Da
• NCBI Official Full Name: Homo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae), mRNA
• NCBI Official Synonym Full Names: autophagy related 5
• NCBI Official Symbol: ATG5
• NCBI Official Synonym Symbols: ASP; APG5; APG5L; hAPG5; APG5-LIKE
• NCBI Protein Information: autophagy protein 5
• UniProt Protein Name: Autophagy protein 5
• Protein Family: Autophagy protein
• UniProt Gene Name: ATG5
• UniProt Synonym Gene Names: APG5L; ASP
• UniProt Entry Name: ATG5_HUMAN

NCBI Description

The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Several transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

Uniprot Description

ATG5: Required for autophagy. Conjugates to ATG12 and associates with isolation membrane to form cup-shaped isolation membrane and autophagosome. The conjugate detaches from the membrane immediately before or after autophagosome formation is completed. The ATG5-ATG12 conjugate forms a complex with several units of ATG16. Interacts with TECPR1; the interaction is direct and does not take place when ATG16 is associated with the ATG5- ATG12 conjugate. By apoptotic stimuli. Ubiquitous. The mRNA is present at similar levels in viable and apoptotic cells, whereas the protein is dramatically highly expressed in apoptotic cells. Belongs to the ATG5 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Autophagy; Apoptosis; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: autophagic vacuole; axoneme; cytoplasm; cytosol; membrane; phagocytic vesicle membrane; pre-autophagosomal structure membrane

Molecular Function: APG8 conjugating enzyme activity; protein binding

Biological Process: autophagic vacuole formation; autophagy; C-terminal protein lipidation; cellular response to nitrogen starvation; macroautophagy; mitochondrion degradation; post-translational protein modification