ATG16L1 cdna clone
ATG16L1 cDNA Clone
Gene Names
ATG16L1; IBD10; WDR30; APG16L; ATG16A; ATG16L
Synonyms
ATG16L1; ATG16L1 cDNA Clone; ATG16L1 cdna clone
Sequence
atggcccaactgaggattaagcaccaagaggaactgactgaattacacaagaaacgtggggagttagctcaactggtgattgacctgaataaccaaatgcagcggaaggacagggagatgcagatgaatgaagcaaaaattgcagaatgtttgcagactatctctgacctggagacggagtgcctagacctgcgcactaagctttgtgaccttgaaagagccaaccagaccctgaaggatgaatatgatgccctgcagatcacttttactgccttggagggaaaactgaggaaaactacggaagagaaccaggagctggtcaccagatggatggctgagaaagcccaggaagccaatcggcttaatgcagagaatgaaaaagactccaggaggcggcaagcccggctgcagaaagagcttgcagaagcagcaaaggaacctctaccagtcgaacaggatgatgacattgaggtcattgtggatgaaacttctgatcacacagaagagacctctcctgtgcgagccatcagcagagcagccactaagcgactctcgcagcctgctggaggccttctggattctatcactaatatctttgggagacgctctgtctcttccttcccagtcccccaggacaatgtggatactcatcctggttctggtaaagaagtgagggtaccagctactgccttgtgtgtcttcgatgcacatgatggggaagtcaacgctgtgcagttcagtccaggttcccggttactggccactggaggcatggaccgcagggttaagctttgggaagtatttggagaaaaatgtgagttcaagggttccctatctggcagtaatgcaggaattacaagcattgaatttgatagtgctggatcttacctcttagcagcttcaaatgattttgcaagccgaatctggactgtggatgattatcgattacggcacacactcacgggacacagtgggaaagtgctgtctgctaagttcctgctggacaatgcgcggattgtctcaggaagtcacgaccggactctcaaactctgggatctacgcagcaaagtctgcataaagacagtgtttgcaggatccagttgcaatgatattgtctgcacagagcaatgtgtaatgagtggacattttgacaagaaaattcgtttctgggacattcgatcagagagcatagttcgagagatggagctgttgggaaagattactgccctggacttaaacccagaaaggactgagctcctgagctgctcccgtgatgacttgctaaaagttattgatctccgaacaaatgctatcaagcagacattcagtgcacctgggttcaagtgcggctctgactggaccagagttgtcttcagccctgatggcagttacgtggcggcaggctctgctgagggctctctgtatatctggagtgtgctcacagggaaagtggaaaaggttctttcaaagcagcacagctcatccatcaatgcggtggcgtggtcgccctctggctcgcacgttgtcagtgtggacaaaggatgcaaagctgtgctgtgggcacagtactga
Sequence Length
1572
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,486 Da
NCBI Official Full Name
Homo sapiens ATG16 autophagy related 16-like 1 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 16 like 1
NCBI Official Symbol
ATG16L1
NCBI Official Synonym Symbols
IBD10; WDR30; APG16L; ATG16A; ATG16L
NCBI Protein Information
autophagy-related protein 16-1
UniProt Protein Name
Autophagy-related protein 16-1
Protein Family
UniProt Gene Name
ATG16L1
UniProt Synonym Gene Names
APG16L
UniProt Entry Name
A16L1_HUMAN
NCBI Description
The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
Uniprot Description
ATG16L1: Plays an essential role in autophagy. Homooligomer. Interacts with ATG5. Part of either the minor and major complexes respectively composed of 4 sets of ATG12-ATG5 and ATG16L1 (400 kDa) or 8 sets of ATG12-ATG5 and ATG16L1 (800 kDa). Belongs to the WD repeat ATG16 family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, peripheral; Autophagy; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 2q37.1
Cellular Component: autophagic vacuole; axoneme; cytosol
Molecular Function: identical protein binding; protein binding; small conjugating protein ligase activity
Biological Process: autophagic vacuole formation; macroautophagy
Disease: Inflammatory Bowel Disease 10
Research Articles on ATG16L1
Similar Products
Product Notes
The ATG16L1 atg16l1 (Catalog #AAA1275620) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaac tgaggattaa gcaccaagag gaactgactg aattacacaa gaaacgtggg gagttagctc aactggtgat tgacctgaat aaccaaatgc agcggaagga cagggagatg cagatgaatg aagcaaaaat tgcagaatgt ttgcagacta tctctgacct ggagacggag tgcctagacc tgcgcactaa gctttgtgac cttgaaagag ccaaccagac cctgaaggat gaatatgatg ccctgcagat cacttttact gccttggagg gaaaactgag gaaaactacg gaagagaacc aggagctggt caccagatgg atggctgaga aagcccagga agccaatcgg cttaatgcag agaatgaaaa agactccagg aggcggcaag cccggctgca gaaagagctt gcagaagcag caaaggaacc tctaccagtc gaacaggatg atgacattga ggtcattgtg gatgaaactt ctgatcacac agaagagacc tctcctgtgc gagccatcag cagagcagcc actaagcgac tctcgcagcc tgctggaggc cttctggatt ctatcactaa tatctttggg agacgctctg tctcttcctt cccagtcccc caggacaatg tggatactca tcctggttct ggtaaagaag tgagggtacc agctactgcc ttgtgtgtct tcgatgcaca tgatggggaa gtcaacgctg tgcagttcag tccaggttcc cggttactgg ccactggagg catggaccgc agggttaagc tttgggaagt atttggagaa aaatgtgagt tcaagggttc cctatctggc agtaatgcag gaattacaag cattgaattt gatagtgctg gatcttacct cttagcagct tcaaatgatt ttgcaagccg aatctggact gtggatgatt atcgattacg gcacacactc acgggacaca gtgggaaagt gctgtctgct aagttcctgc tggacaatgc gcggattgtc tcaggaagtc acgaccggac tctcaaactc tgggatctac gcagcaaagt ctgcataaag acagtgtttg caggatccag ttgcaatgat attgtctgca cagagcaatg tgtaatgagt ggacattttg acaagaaaat tcgtttctgg gacattcgat cagagagcat agttcgagag atggagctgt tgggaaagat tactgccctg gacttaaacc cagaaaggac tgagctcctg agctgctccc gtgatgactt gctaaaagtt attgatctcc gaacaaatgc tatcaagcag acattcagtg cacctgggtt caagtgcggc tctgactgga ccagagttgt cttcagccct gatggcagtt acgtggcggc aggctctgct gagggctctc tgtatatctg gagtgtgctc acagggaaag tggaaaaggt tctttcaaag cagcacagct catccatcaa tgcggtggcg tggtcgccct ctggctcgca cgttgtcagt gtggacaaag gatgcaaagc tgtgctgtgg gcacagtact ga. It is sometimes possible for the material contained within the vial of "ATG16L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
