Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF7 cdna clone

ATF7 cDNA Clone

Gene Names
ATF7; ATFA
Synonyms
ATF7; ATF7 cDNA Clone; ATF7 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagacgacagaccgtttgtgtgcaatgccacgggctgtggacagagatttacaaacgaggaccacctggcagttcataaacacaagcatgagatgacattgaaatttggcccagcccgaactgattcagtcatcattgcagatcaaacgcctactccaactagattcctgaagaactgtgaggaggtgggactcttcaatgaactagctagctcctttgaacatgaattcaagaaagctgcagatgaggatgagaaaaaggcaagaagcaggactgttgccaaaaaactggtggtattcagacctaggctatttttattgtgctttgggataattttcttaattggttaa
Sequence Length
354
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,757 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 7, mRNA
NCBI Official Synonym Full Names
activating transcription factor 7
NCBI Official Symbol
ATF7
NCBI Official Synonym Symbols
ATFA
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-7
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-7
UniProt Gene Name
ATF7
UniProt Synonym Gene Names
ATFA; cAMP-dependent transcription factor ATF-7
UniProt Entry Name
ATF7_HUMAN

Uniprot Description

ATF7: Plays important functions in early cell signaling. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AG][AG]- 3'), a sequence present in many viral and cellular promoters. Activator of the NF-ELAM1/delta-A site of the E-selectin promoter. Has no intrinsic transcriptional activity, but activates transcription on formation of JUN or FOS heterodimers. Also can bind TRE promoter sequences when heterodimerized with members of the JUN family. Belongs to the bZIP family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 12q13

Molecular Function: enzyme binding; mitogen-activated protein kinase binding; protein binding; transcription factor binding

Biological Process: regulation of transcription, DNA-dependent

Research Articles on ATF7

Similar Products

Product Notes

The ATF7 atf7 (Catalog #AAA1266770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagacg acagaccgtt tgtgtgcaat gccacgggct gtggacagag atttacaaac gaggaccacc tggcagttca taaacacaag catgagatga cattgaaatt tggcccagcc cgaactgatt cagtcatcat tgcagatcaa acgcctactc caactagatt cctgaagaac tgtgaggagg tgggactctt caatgaacta gctagctcct ttgaacatga attcaagaaa gctgcagatg aggatgagaa aaaggcaaga agcaggactg ttgccaaaaa actggtggta ttcagaccta ggctattttt attgtgcttt gggataattt tcttaattgg ttaa. It is sometimes possible for the material contained within the vial of "ATF7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.