Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF6B cdna clone

ATF6B cDNA Clone

Gene Names
ATF6B; G13; CREBL1; CREB-RP
Synonyms
ATF6B; ATF6B cDNA Clone; ATF6B cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagctgatgctgctcagcgagattgctgacccgacgcgtttcttcaccgacaacctgcttagcccggaggactggggtctgcagaacagcaccttgtattctggcctagatgaagtggccgaggagcagacgcagctcttccgttgcccggagcaggatgtcccgtttgacggcagctccctggacgtggggatggatgtcagcccctctgagcccccatgggaactcctgccgatcttcccagatcttcaggtgaagtctgagccatcttccccctgctcttcctcctccctcagctccgagtcatcgcgtctctccacagagccatccagcgaggctcttggggtaggggaggtgctccatgtgaagacagagtccttggcacccccactgtgtctcctgggagatgacccaacatcctcatttgaaaccgtccagatcaacgttatccccacctctgatgattcctcagatgtccagaccaagatagaacctgtctctccatgttcttccgtcaactctgaggcctccctgctctcggccgactcctccagccaggcttttataggagaggaggtcctggaagtgaagacagagtccctgtccccttcaggatgcctcctgtgggatgtcccagccccctcacttggagctgtccagatcagcatgggcccatcccttgatggctcctcaggcaaagccctgcccacccggaagccgccactgcagcccaaacctgtagtgctaaccactgtcccaatgccatccagagctgtgtctcccagcaccacagtccttctgcagtccctcgtccagccacccccaggtactgaagaaggagaaaagggccgggcatggtggctcacgccggtaatcccagcactttgggaggctgaggcgggcgaatcacctgaggtcagaagtttaagaccagcctggccaacgtggtga
Sequence Length
957
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,412 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 6 beta, mRNA
NCBI Official Synonym Full Names
activating transcription factor 6 beta
NCBI Official Symbol
ATF6B
NCBI Official Synonym Symbols
G13; CREBL1; CREB-RP
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-6 beta
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-6 beta
UniProt Gene Name
ATF6B
UniProt Synonym Gene Names
CREBL1; G13; cAMP-dependent transcription factor ATF-6 beta; ATF6-beta; Creb-rp
UniProt Entry Name
ATF6B_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

Uniprot Description

ATF6B: Transcriptional factor that acts in the unfolded protein response (UPR) pathway by activating UPR target genes induced during ER stress. Binds DNA on the 5'-CCAC[GA]-3' half of the ER stress response element (ERSE) (5'-CCAATN(9)CCAC[GA]-3') when NF-Y is bound to ERSE. Belongs to the bZIP family. ATF subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: endoplasmic reticulum membrane; Golgi apparatus; integral to endoplasmic reticulum membrane; intracellular; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: signal transduction

Research Articles on ATF6B

Similar Products

Product Notes

The ATF6B atf6b (Catalog #AAA1266596) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagc tgatgctgct cagcgagatt gctgacccga cgcgtttctt caccgacaac ctgcttagcc cggaggactg gggtctgcag aacagcacct tgtattctgg cctagatgaa gtggccgagg agcagacgca gctcttccgt tgcccggagc aggatgtccc gtttgacggc agctccctgg acgtggggat ggatgtcagc ccctctgagc ccccatggga actcctgccg atcttcccag atcttcaggt gaagtctgag ccatcttccc cctgctcttc ctcctccctc agctccgagt catcgcgtct ctccacagag ccatccagcg aggctcttgg ggtaggggag gtgctccatg tgaagacaga gtccttggca cccccactgt gtctcctggg agatgaccca acatcctcat ttgaaaccgt ccagatcaac gttatcccca cctctgatga ttcctcagat gtccagacca agatagaacc tgtctctcca tgttcttccg tcaactctga ggcctccctg ctctcggccg actcctccag ccaggctttt ataggagagg aggtcctgga agtgaagaca gagtccctgt ccccttcagg atgcctcctg tgggatgtcc cagccccctc acttggagct gtccagatca gcatgggccc atcccttgat ggctcctcag gcaaagccct gcccacccgg aagccgccac tgcagcccaa acctgtagtg ctaaccactg tcccaatgcc atccagagct gtgtctccca gcaccacagt ccttctgcag tccctcgtcc agccaccccc aggtactgaa gaaggagaaa agggccgggc atggtggctc acgccggtaa tcccagcact ttgggaggct gaggcgggcg aatcacctga ggtcagaagt ttaagaccag cctggccaac gtggtga. It is sometimes possible for the material contained within the vial of "ATF6B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.