Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF4 cdna clone

ATF4 cDNA Clone

Gene Names
ATF4; CREB2; TXREB; CREB-2; TAXREB67
Synonyms
ATF4; ATF4 cDNA Clone; ATF4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgaaatgagcttcctgagcagcgaggtgttggtgggggacttgatgtcccccttcgacccgtcgggtttgggggctgaagaaagcctaggtctcttagatgattacctggaggtggccaagcacttcaaacctcatgggttctccagcgacaaggctaaggcgggctcctccgaatggctggctgtggatgggttggtcagtccctccaacaacagcaaggaggatgccttctccgggacagattggatgttggagaaaatggatttgaaggagttcgacttggatgccctgttgggtatagatgacctggaaaccatgccagatgaccttctgaccacgttggatgacacttgtgatctctttgcccccctagtccaggagactaataagcagcccccccagacggtgaacccaattggccatctcccagaaagtttaacaaaacccgaccaggttgcccccttcaccttcttacaacctcttcccctttccccaggggtcctgtcctccactccagatcattcctttagtttagagctgggcagtgaagtggatatcactgaaggagataggaagccagactacactgcttacgttgccatgatccctcagtgcataaaggaggaagacaccccttcagataatgatagtggcatctgtatgagcccagagtcctatctggggtctcctcagcacagcccctctaccaggggctctccaaataggagcctcccatctccaggtgttctctgtgggtctgcccgtcccaaaccttacgatcctcctggagagaagatggtagcagcaaaagtaaagggtgagaaactggataagaagctgaaaaaaatggagcaaaacaagacagcagccactaggtaccgccagaagaagagggcggagcaggaggctcttactggtgagtgcaaagagctggaaaagaagaacgaggctctaaaagagagggcggattccctggccaaggagatccagtacctgaaagatttgatagaagaggtccgcaaggcaagggggaagaaaagggtcccctag
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
468
Molecular Weight
38,590 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 4 (tax-responsive enhancer element B67), mRNA
NCBI Official Synonym Full Names
activating transcription factor 4
NCBI Official Symbol
ATF4
NCBI Official Synonym Symbols
CREB2; TXREB; CREB-2; TAXREB67
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-4
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-4
UniProt Gene Name
ATF4
UniProt Synonym Gene Names
CREB2; TXREB; cAMP-dependent transcription factor ATF-4; CREB-2; cAMP-responsive element-binding protein 2; TaxREB67
UniProt Entry Name
ATF4_HUMAN

NCBI Description

This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]

Uniprot Description

ATF-4: a transcription factor that is a member of the leucine zipper family. Isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). Involved in cisplatin resistance. Other members of the family include AP-1 transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. Two alternatively spliced isoforms have been described.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; neuron projection; nucleoplasm; nucleus

Molecular Function: DNA binding; leucine zipper domain binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: amino acid metabolic process; cellular response to amino acid starvation; cellular response to glucose starvation; circadian regulation of gene expression; gluconeogenesis; mRNA transcription from RNA polymerase II promoter; negative regulation of translation initiation in response to stress; positive regulation of apoptosis; positive regulation of neuron apoptosis; positive regulation of transcription from RNA polymerase I promoter; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; transcription from RNA polymerase II promoter

Research Articles on ATF4

Similar Products

Product Notes

The ATF4 atf4 (Catalog #AAA1277988) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgaaa tgagcttcct gagcagcgag gtgttggtgg gggacttgat gtcccccttc gacccgtcgg gtttgggggc tgaagaaagc ctaggtctct tagatgatta cctggaggtg gccaagcact tcaaacctca tgggttctcc agcgacaagg ctaaggcggg ctcctccgaa tggctggctg tggatgggtt ggtcagtccc tccaacaaca gcaaggagga tgccttctcc gggacagatt ggatgttgga gaaaatggat ttgaaggagt tcgacttgga tgccctgttg ggtatagatg acctggaaac catgccagat gaccttctga ccacgttgga tgacacttgt gatctctttg cccccctagt ccaggagact aataagcagc ccccccagac ggtgaaccca attggccatc tcccagaaag tttaacaaaa cccgaccagg ttgccccctt caccttctta caacctcttc ccctttcccc aggggtcctg tcctccactc cagatcattc ctttagttta gagctgggca gtgaagtgga tatcactgaa ggagatagga agccagacta cactgcttac gttgccatga tccctcagtg cataaaggag gaagacaccc cttcagataa tgatagtggc atctgtatga gcccagagtc ctatctgggg tctcctcagc acagcccctc taccaggggc tctccaaata ggagcctccc atctccaggt gttctctgtg ggtctgcccg tcccaaacct tacgatcctc ctggagagaa gatggtagca gcaaaagtaa agggtgagaa actggataag aagctgaaaa aaatggagca aaacaagaca gcagccacta ggtaccgcca gaagaagagg gcggagcagg aggctcttac tggtgagtgc aaagagctgg aaaagaagaa cgaggctcta aaagagaggg cggattccct ggccaaggag atccagtacc tgaaagattt gatagaagag gtccgcaagg caagggggaa gaaaagggtc ccctag. It is sometimes possible for the material contained within the vial of "ATF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.