Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATAD2 cdna clone

ATAD2 cDNA Clone

Gene Names
ATAD2; ANCCA; CT137; PRO2000
Synonyms
ATAD2; ATAD2 cDNA Clone; ATAD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacctttcatctgtaatcagtaaaattgatctacacaagtatctgactgtgaaagactatttgagagatattgatctaatctgtagtaatgccttagaatacaatccagatagagatcctggagatcgtcttattaggcatagagcctgtgctttaagagatactgcctatgccataattaaagaagaacttgatgaagactttgagcagctctgtgaagaaattcaggaatctagaaagaaaagaggttgtagctcctccaaatatgccccgtcttactaccatgtgatgccaaagcaaaattccactcttgttggtgataaaagatcagacccagagcagaatgaaaagctaaagacaccgagtactcctgtggcttgcagcactcctgctcagttgaagaggaaaattcgcaaaaagtcaaactggtacttaggcaccataaaaaagcgaaggaagatttcacaggcaaaggatgatagccagaatgccatagatcacaaaattgagagtgatacagaggaaactcaagacacaagtgtagatcataatgagaccggaaacacaggagagtcttcggtggaagaaaatgaaaaacagcaaaatgcctctgaaagcaaactggaattgagaaataattcaaatacttgtaatatagagaatgagcttgaagactctaggaagactacagcatgtacagaattgagagacaagattgcttgtaatggagatgcttctagctctcagataatacatatttctgatgaaaatgaaggaaaagaaatgtgtgttctgcgaatgactcgagctagacgttcccaggtagaacagcagcagctcatcactgttgaaaaggctttggcaattctttctcagcctacaccctcacttgttgtggatcatgagcgattaaaaaatcttttgaagactgttgttaaaaaaagtcaaaactacaacatatttcagttggaaaatttgtatgcagtaatcagccaatgtatttatcggcatcgcaaggaccatgataaaacatcacttattcagaaaatggagcaagaggtagaaaacttcagttgttccagatga
Sequence Length
1089
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,986 Da
NCBI Official Full Name
Homo sapiens ATPase family, AAA domain containing 2, mRNA
NCBI Official Synonym Full Names
ATPase family, AAA domain containing 2
NCBI Official Symbol
ATAD2
NCBI Official Synonym Symbols
ANCCA; CT137; PRO2000
NCBI Protein Information
ATPase family AAA domain-containing protein 2
UniProt Protein Name
ATPase family AAA domain-containing protein 2
UniProt Gene Name
ATAD2
UniProt Synonym Gene Names
ANCCA
UniProt Entry Name
ATAD2_HUMAN

NCBI Description

A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Uniprot Description

ATAD2: a member of the AAA ATPase family. Contains a bromodomain, a domain known to interact specifically with acetylated lysine. Two alternatively spliced isoforms of the human protein have been reported.

Protein type: EC 3.6.1.3; Cancer Testis Antigen (CTA); Hydrolase

Chromosomal Location of Human Ortholog: 8q24.13

Cellular Component: nucleoplasm; nucleus

Molecular Function: ATPase activity; chromatin binding; histone binding

Biological Process: negative regulation of chromatin silencing; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent

Research Articles on ATAD2

Similar Products

Product Notes

The ATAD2 atad2 (Catalog #AAA1278751) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccttt catctgtaat cagtaaaatt gatctacaca agtatctgac tgtgaaagac tatttgagag atattgatct aatctgtagt aatgccttag aatacaatcc agatagagat cctggagatc gtcttattag gcatagagcc tgtgctttaa gagatactgc ctatgccata attaaagaag aacttgatga agactttgag cagctctgtg aagaaattca ggaatctaga aagaaaagag gttgtagctc ctccaaatat gccccgtctt actaccatgt gatgccaaag caaaattcca ctcttgttgg tgataaaaga tcagacccag agcagaatga aaagctaaag acaccgagta ctcctgtggc ttgcagcact cctgctcagt tgaagaggaa aattcgcaaa aagtcaaact ggtacttagg caccataaaa aagcgaagga agatttcaca ggcaaaggat gatagccaga atgccataga tcacaaaatt gagagtgata cagaggaaac tcaagacaca agtgtagatc ataatgagac cggaaacaca ggagagtctt cggtggaaga aaatgaaaaa cagcaaaatg cctctgaaag caaactggaa ttgagaaata attcaaatac ttgtaatata gagaatgagc ttgaagactc taggaagact acagcatgta cagaattgag agacaagatt gcttgtaatg gagatgcttc tagctctcag ataatacata tttctgatga aaatgaagga aaagaaatgt gtgttctgcg aatgactcga gctagacgtt cccaggtaga acagcagcag ctcatcactg ttgaaaaggc tttggcaatt ctttctcagc ctacaccctc acttgttgtg gatcatgagc gattaaaaaa tcttttgaag actgttgtta aaaaaagtca aaactacaac atatttcagt tggaaaattt gtatgcagta atcagccaat gtatttatcg gcatcgcaag gaccatgata aaacatcact tattcagaaa atggagcaag aggtagaaaa cttcagttgt tccagatga. It is sometimes possible for the material contained within the vial of "ATAD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.