Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASTN2 cdna clone

ASTN2 cDNA Clone

Gene Names
ASTN2; bA67K19.1
Synonyms
ASTN2; ASTN2 cDNA Clone; ASTN2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccttcatcacctacctctcaggtttgctgacagcccagatgctgtcagatgaccagctcatttcaggtgtggagattcgctgtgaggagaaggggcgctgtccatctacctgtcacctttgccgccggccaggcaaggagcagctgagccccacaccagtgctgctggataacaaccgtgtggtgccactttataccctcatccaagacaatggcacaaaggaggccttcaagagtgcactgatgagttcctactggtgctcagggaaaggggatgtgatcgatgactggtgcaggtgtgacctcagcgcctttgatgccaatgggctccccaactgcagcccccttctgcagccggtgctgcggctgtccccaacagtggagccctccagtactgtggtctccttggagtgggtggatgttcagccagctattgggaccaaggtctccgactatattctgcagcataagaaagtggatgaatacacagacactgacctgtacacagtttattgctggattacatttattgatttgcggatattgaaccagccttgcatcccagggatgaagccaacttga
Sequence Length
585
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,561 Da
NCBI Official Full Name
Homo sapiens astrotactin 2, mRNA
NCBI Official Synonym Full Names
astrotactin 2
NCBI Official Symbol
ASTN2
NCBI Official Synonym Symbols
bA67K19.1
NCBI Protein Information
astrotactin-2
UniProt Protein Name
Astrotactin-2
Protein Family
UniProt Gene Name
ASTN2
UniProt Synonym Gene Names
KIAA0634
UniProt Entry Name
ASTN2_HUMAN

NCBI Description

This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Uniprot Description

ASTN2: a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 9q33.1

Molecular Function: calcium ion binding; inositol 1,3,4,5 tetrakisphosphate binding

Research Articles on ASTN2

Similar Products

Product Notes

The ASTN2 astn2 (Catalog #AAA1273701) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccttca tcacctacct ctcaggtttg ctgacagccc agatgctgtc agatgaccag ctcatttcag gtgtggagat tcgctgtgag gagaaggggc gctgtccatc tacctgtcac ctttgccgcc ggccaggcaa ggagcagctg agccccacac cagtgctgct ggataacaac cgtgtggtgc cactttatac cctcatccaa gacaatggca caaaggaggc cttcaagagt gcactgatga gttcctactg gtgctcaggg aaaggggatg tgatcgatga ctggtgcagg tgtgacctca gcgcctttga tgccaatggg ctccccaact gcagccccct tctgcagccg gtgctgcggc tgtccccaac agtggagccc tccagtactg tggtctcctt ggagtgggtg gatgttcagc cagctattgg gaccaaggtc tccgactata ttctgcagca taagaaagtg gatgaataca cagacactga cctgtacaca gtttattgct ggattacatt tattgatttg cggatattga accagccttg catcccaggg atgaagccaa cttga. It is sometimes possible for the material contained within the vial of "ASTN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.