Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASNS cdna clone

ASNS cDNA Clone

Gene Names
ASNS; TS11; ASNSD
Synonyms
ASNS; ASNS cDNA Clone; ASNS cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaatgcagccaattcgagtgaagaaatatccgtatttgtggctctgttacaatggtgaaatctacaaccataagaagatgcaacagcattttgaatttgaataccagaccaaagtggatggtgagataatccttcatctttatgacaaaggaggaattgagcaaacaatttgtatgttggatggtgtgtttgcatttgttttactggatactgccaataagaaagtgttcctgggtagagatacatatggagtcagacctttgtttaaagcaatgacagaagatggatttttggctgtatgttcagaagctaaaggtcttgttacattgaagcactccgcgactccctttttaaaagtggagccttttcttcctggacactatgaagttttggatttaaagccaaatggcaaagttgcatccgtggaaatggttaaatatcatcactgtcgggatgaacccctgcacgccctctatgacaatgtggagaaactctttccaggttttgagatagaaactgtgaagaacaacctcaggatcctttttaataatgctgtaaagaaacgtttgatgacagacagaaggattggctgccttttatcagggggcttggactccagcttggttgctgccactctgttgaagcagctgaaagaagcccaagtacagtatcctctccagacatttgcaattggcatggaagacagccccgatttactggctgctagaaaggtggcagatcatattggaagtgaacattatgaagtcctttttaactctgaggaaggcattcaggctctggatgaagtcatattttccttggaaacttatgacattacaacagttcgtgcttcagtaggtatgtatttaatttccaagtatattcggaagaacacagatagcgtggtgatcttctctggagaaggatcagatgaacttacgcagggttacatatattttcacaaggctccttctcctgaaaaagccgaggaggagagtgagaggcttctgagggaactctatttgtttgatgttctccgcgcagatcgaactactgctgcccatggtcttgaactgagagtcccatttctagatcatcgattttcttcctattacttgtctctgccaccagaaatgagaattccaaagaatgggatagaaaaacatctcctgagagagacgtttgaggattccaatctgatacccaaagagattctctggcgaccaaaagaagccttcagtgatggaataacttcagttaagaattcctggtttaagattttacaggaatacgttgaacatcaggttgatgatgcaatgatggcaaatgcagcccagaaatttcccttcaatactcctaaaaccaaagaaggatattactaccgtcaagtctttgaacgccattacccaggccgggctgactggctgagccattactggatgcccaagtggatcaatgccactgacccttctgcccgcacgctgacccactacaagtcagctgtcaaagcttag
Sequence Length
1686
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
440
Molecular Weight
54,818 Da
NCBI Official Full Name
Homo sapiens asparagine synthetase, mRNA
NCBI Official Synonym Full Names
asparagine synthetase (glutamine-hydrolyzing)
NCBI Official Symbol
ASNS
NCBI Official Synonym Symbols
TS11; ASNSD
NCBI Protein Information
asparagine synthetase [glutamine-hydrolyzing]
UniProt Protein Name
Asparagine synthetase [glutamine-hydrolyzing]
Protein Family
UniProt Gene Name
ASNS
UniProt Synonym Gene Names
TS11
UniProt Entry Name
ASNS_HUMAN

NCBI Description

The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]

Uniprot Description

ASNS: 3 isoforms of the human protein are produced by alternative splicing

Protein type: Cell cycle regulation; Energy Metabolism - nitrogen; Ligase; Amino Acid Metabolism - alanine, aspartate and glutamate; EC 6.3.5.4

Chromosomal Location of Human Ortholog: 7q21.3

Cellular Component: cytosol

Molecular Function: asparagine synthase (glutamine-hydrolyzing) activity; protein binding; protein homodimerization activity

Biological Process: amino acid biosynthetic process; asparagine biosynthetic process; cellular response to glucose starvation; glutamine metabolic process; negative regulation of apoptosis; positive regulation of mitotic cell cycle

Disease: Asparagine Synthetase Deficiency

Research Articles on ASNS

Similar Products

Product Notes

The ASNS asns (Catalog #AAA1276121) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtggca tttgggcgct gtttggcagt gatgattgcc tttctgttca gtgtctgagt gctatgaaga ttgcacacag aggtccagat gcattccgtt ttgagaatgt caatggatac accaactgct gctttggatt tcaccggttg gcggtagttg acccgctgtt tggaatgcag ccaattcgag tgaagaaata tccgtatttg tggctctgtt acaatggtga aatctacaac cataagaaga tgcaacagca ttttgaattt gaataccaga ccaaagtgga tggtgagata atccttcatc tttatgacaa aggaggaatt gagcaaacaa tttgtatgtt ggatggtgtg tttgcatttg ttttactgga tactgccaat aagaaagtgt tcctgggtag agatacatat ggagtcagac ctttgtttaa agcaatgaca gaagatggat ttttggctgt atgttcagaa gctaaaggtc ttgttacatt gaagcactcc gcgactccct ttttaaaagt ggagcctttt cttcctggac actatgaagt tttggattta aagccaaatg gcaaagttgc atccgtggaa atggttaaat atcatcactg tcgggatgaa cccctgcacg ccctctatga caatgtggag aaactctttc caggttttga gatagaaact gtgaagaaca acctcaggat cctttttaat aatgctgtaa agaaacgttt gatgacagac agaaggattg gctgcctttt atcagggggc ttggactcca gcttggttgc tgccactctg ttgaagcagc tgaaagaagc ccaagtacag tatcctctcc agacatttgc aattggcatg gaagacagcc ccgatttact ggctgctaga aaggtggcag atcatattgg aagtgaacat tatgaagtcc tttttaactc tgaggaaggc attcaggctc tggatgaagt catattttcc ttggaaactt atgacattac aacagttcgt gcttcagtag gtatgtattt aatttccaag tatattcgga agaacacaga tagcgtggtg atcttctctg gagaaggatc agatgaactt acgcagggtt acatatattt tcacaaggct ccttctcctg aaaaagccga ggaggagagt gagaggcttc tgagggaact ctatttgttt gatgttctcc gcgcagatcg aactactgct gcccatggtc ttgaactgag agtcccattt ctagatcatc gattttcttc ctattacttg tctctgccac cagaaatgag aattccaaag aatgggatag aaaaacatct cctgagagag acgtttgagg attccaatct gatacccaaa gagattctct ggcgaccaaa agaagccttc agtgatggaa taacttcagt taagaattcc tggtttaaga ttttacagga atacgttgaa catcaggttg atgatgcaat gatggcaaat gcagcccaga aatttccctt caatactcct aaaaccaaag aaggatatta ctaccgtcaa gtctttgaac gccattaccc aggccgggct gactggctga gccattactg gatgcccaag tggatcaatg ccactgaccc ttctgcccgc acgctgaccc actacaagtc agctgtcaaa gcttag. It is sometimes possible for the material contained within the vial of "ASNS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.