Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASAP2 cdna clone

ASAP2 cDNA Clone

Gene Names
ASAP2; PAP; PAG3; AMAP2; DDEF2; SHAG1; CENTB3; Pap-alpha
Synonyms
ASAP2; ASAP2 cDNA Clone; ASAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggaccagatctccgtgtcggaattcgtggccgagacccatgaggactacaaggcgcccacggcctccagcttcaccacccgcacggcgcagtgccggaacactgtggcggccatcgaggaggctttggacgtggaccggatggttctttacaaaatgaagaaatccgtgaaagcaatcaacagctctgggctggctcacgtggaaaatgaagagcagtacacccaggctctggagaagtttggcggcaaccgtgtatgcagagatgacccagatttaggaagtgcgttcctgaagttctcagtgtttacaaaggagttgacagcacttttcaaaaacctgattcagaatatgaacaacataatctccttccctttggacagtttgctgaagggggacctgaaaggagtgaaaggggatctgaaaaagccttttgataaagcttggaaggactatgaaacaaaaataaccaagatagaaaaggagaaaaaggaacacgccaagctccatgggatgattcggactgaaataagcggagcggaaattgccgaagagatggaaaaggagaggcgcttcttccagctacagatgtgcgagtatctgctgaaggtcaacgaaatcaagattaaaaagggagtagatttacttcagaatctgatcaaatactttcatgcccaatgcaatttttttcaggatggactcaaagccgtggaaagcctcaaaccttccattgaaacgctgtctacggatcttcacacgatcaaacaggcccaggatgaagaaagaaggcagttgatacagcttcgagatattttgaaatccgcattgcaggttgaacagaaagaggactcccaaattcgtcagagcacagcttatagcttacatcagcctcagggaaacaaggaacatgggaccgagcggaacggcagcctctacaagaagagtgacgggatccgaaaagtgtggcagaaaaggaaatgttcagttaaaaatggttttctgaccatatcccatggtaccgctaaccggcctcctgcaaagctcaacctgctaacctgccaggtgaagaccaaccctgaggagaagaagtgctttgaccttatttcacatgacagaacttaccactttcaagctgaagatgaacaggaatgtcaaatatggatgtctgtgctgcaaaatagcaaagaagaagctttaaacaatgcatttaagggggatgacaatactggagaaaataacatcgtccaagaactgacaaaggagatcatctcagaagtgcagaggatgacgggcaatgacgtctgctgtgactgtggggcgccagatcctacatggctttccaccaacctgggcatcctgacctgcatcgagtgttccggaatccaccgagagctgggggttcattattccaggatgcagtccctgaccttagatgtactgggaacatctgagctgctgctcgccaagaatattgggaatgcaggctttaatgagatcatggaatgttgcctaccagctgaggactcagtcaaacccaacccaggcagcgacatgaatgcaagaaaggactacatcacagccaagtacatcgagaggagatacgcaaggaagaagcacgcggataacgcggcgaagcttcacagtctttgcgaggccgtcaaaacgagagatatttttggattgctccaagcttatgctgatggtgtggatcttacggaaaaaatcccactggccaacggacatgagccggatgaaacggccctccaccttgcagtcagatccgtggatcgaacctctcttcacattgtagactttttagttcagaacagtgggaacctggataaacagacagggaaaggcagcacagccctgcactactgctgcctgaccgacaatgccgagtgcctcaagttgctcctgcgggggaaggcctccatcgagatagcaaacgagtcaggagagactccgctggacattgccaagcgcctcaagcacgagcactgtgaggagctgctgacccaagccttatctggaagatttaattctcacgttcacgttgaatatgaatggcgactactccacgaagacctggatgaaagtgatgacgacatggatgagaaattgcagcccagtcccaaccggcgggaagaccggcccatcagcttctaccagctgggctccaaccagcttcagtctaacgctgtatctttggccagagatgctgcaaaccttgccaaggacaagcagagggctttcatgcccagcatcttgcagaatgagacttacggagccctcctgagtggcagcccacctcccgcccagcctgcagcccccagcaccaccagcgcccccccgcttcctccacggaatgttggcaaagatcccctgacccccacgccgcccccacccgttgccaagacgcccagcgtaatggaagccttgagccagccgagcaagcctgccccgcctgggatctcacagatcaggcccccacctctgcccccacagccgcccagccgcctcccgcagaagaagcctgcgccgggggctgacaagtccaccccactgaccaacaaaggccaaccgagaggacctgtggatctctctgcaacggaagctctgggtcctctgtccaatgctatggtcctgcagccccctgcacccatgcctaggaagtcgcaggcaaccaagttgaagcctaagcgggtgaaagcgctctataactgtgtggctgacaaccccgatgagctcaccttctccgagggggatgtgatcatcgtggacggggaggaggaccaggagtggtggattggccacattgatggagatcctggtcgcaaaggcgcattcccggtgtcatttgtgcactttatcgctgactga
Sequence Length
2886
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,982 Da
NCBI Official Full Name
Homo sapiens ArfGAP with SH3 domain, ankyrin repeat and PH domain 2, mRNA
NCBI Official Synonym Full Names
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
NCBI Official Symbol
ASAP2
NCBI Official Synonym Symbols
PAP; PAG3; AMAP2; DDEF2; SHAG1; CENTB3; Pap-alpha
NCBI Protein Information
arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 2
UniProt Protein Name
Arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 2
UniProt Gene Name
ASAP2
UniProt Synonym Gene Names
DDEF2; KIAA0400; PAG3; PAP
UniProt Entry Name
ASAP2_HUMAN

NCBI Description

This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Uniprot Description

DDEF2: Activates the small GTPases ARF1, ARF5 and ARF6. Regulates the formation of post-Golgi vesicles and modulates constitutive secretion. Modulates phagocytosis mediated by Fc gamma receptor and ARF6. Modulates PXN recruitment to focal contacts and cell migration. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; GAPs; GAPs, ARF

Chromosomal Location of Human Ortholog: 2p25|2p24

Molecular Function: enzyme activator activity; protein binding

Research Articles on ASAP2

Similar Products

Product Notes

The ASAP2 asap2 (Catalog #AAA1269684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggacc agatctccgt gtcggaattc gtggccgaga cccatgagga ctacaaggcg cccacggcct ccagcttcac cacccgcacg gcgcagtgcc ggaacactgt ggcggccatc gaggaggctt tggacgtgga ccggatggtt ctttacaaaa tgaagaaatc cgtgaaagca atcaacagct ctgggctggc tcacgtggaa aatgaagagc agtacaccca ggctctggag aagtttggcg gcaaccgtgt atgcagagat gacccagatt taggaagtgc gttcctgaag ttctcagtgt ttacaaagga gttgacagca cttttcaaaa acctgattca gaatatgaac aacataatct ccttcccttt ggacagtttg ctgaaggggg acctgaaagg agtgaaaggg gatctgaaaa agccttttga taaagcttgg aaggactatg aaacaaaaat aaccaagata gaaaaggaga aaaaggaaca cgccaagctc catgggatga ttcggactga aataagcgga gcggaaattg ccgaagagat ggaaaaggag aggcgcttct tccagctaca gatgtgcgag tatctgctga aggtcaacga aatcaagatt aaaaagggag tagatttact tcagaatctg atcaaatact ttcatgccca atgcaatttt tttcaggatg gactcaaagc cgtggaaagc ctcaaacctt ccattgaaac gctgtctacg gatcttcaca cgatcaaaca ggcccaggat gaagaaagaa ggcagttgat acagcttcga gatattttga aatccgcatt gcaggttgaa cagaaagagg actcccaaat tcgtcagagc acagcttata gcttacatca gcctcaggga aacaaggaac atgggaccga gcggaacggc agcctctaca agaagagtga cgggatccga aaagtgtggc agaaaaggaa atgttcagtt aaaaatggtt ttctgaccat atcccatggt accgctaacc ggcctcctgc aaagctcaac ctgctaacct gccaggtgaa gaccaaccct gaggagaaga agtgctttga ccttatttca catgacagaa cttaccactt tcaagctgaa gatgaacagg aatgtcaaat atggatgtct gtgctgcaaa atagcaaaga agaagcttta aacaatgcat ttaaggggga tgacaatact ggagaaaata acatcgtcca agaactgaca aaggagatca tctcagaagt gcagaggatg acgggcaatg acgtctgctg tgactgtggg gcgccagatc ctacatggct ttccaccaac ctgggcatcc tgacctgcat cgagtgttcc ggaatccacc gagagctggg ggttcattat tccaggatgc agtccctgac cttagatgta ctgggaacat ctgagctgct gctcgccaag aatattggga atgcaggctt taatgagatc atggaatgtt gcctaccagc tgaggactca gtcaaaccca acccaggcag cgacatgaat gcaagaaagg actacatcac agccaagtac atcgagagga gatacgcaag gaagaagcac gcggataacg cggcgaagct tcacagtctt tgcgaggccg tcaaaacgag agatattttt ggattgctcc aagcttatgc tgatggtgtg gatcttacgg aaaaaatccc actggccaac ggacatgagc cggatgaaac ggccctccac cttgcagtca gatccgtgga tcgaacctct cttcacattg tagacttttt agttcagaac agtgggaacc tggataaaca gacagggaaa ggcagcacag ccctgcacta ctgctgcctg accgacaatg ccgagtgcct caagttgctc ctgcggggga aggcctccat cgagatagca aacgagtcag gagagactcc gctggacatt gccaagcgcc tcaagcacga gcactgtgag gagctgctga cccaagcctt atctggaaga tttaattctc acgttcacgt tgaatatgaa tggcgactac tccacgaaga cctggatgaa agtgatgacg acatggatga gaaattgcag cccagtccca accggcggga agaccggccc atcagcttct accagctggg ctccaaccag cttcagtcta acgctgtatc tttggccaga gatgctgcaa accttgccaa ggacaagcag agggctttca tgcccagcat cttgcagaat gagacttacg gagccctcct gagtggcagc ccacctcccg cccagcctgc agcccccagc accaccagcg cccccccgct tcctccacgg aatgttggca aagatcccct gacccccacg ccgcccccac ccgttgccaa gacgcccagc gtaatggaag ccttgagcca gccgagcaag cctgccccgc ctgggatctc acagatcagg cccccacctc tgcccccaca gccgcccagc cgcctcccgc agaagaagcc tgcgccgggg gctgacaagt ccaccccact gaccaacaaa ggccaaccga gaggacctgt ggatctctct gcaacggaag ctctgggtcc tctgtccaat gctatggtcc tgcagccccc tgcacccatg cctaggaagt cgcaggcaac caagttgaag cctaagcggg tgaaagcgct ctataactgt gtggctgaca accccgatga gctcaccttc tccgaggggg atgtgatcat cgtggacggg gaggaggacc aggagtggtg gattggccac attgatggag atcctggtcg caaaggcgca ttcccggtgt catttgtgca ctttatcgct gactga. It is sometimes possible for the material contained within the vial of "ASAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.