Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ART5 cdna clone

ART5 cDNA Clone

Gene Names
ART5; ARTC5
Synonyms
ART5; ART5 cDNA Clone; ART5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctggcggctttgatgatcgccctcggcagcctcggcctccacacctggcaggcccaggctgttcccaccatcctgcccctgggcctggctccagacacctttgacgatacctatgtgggttgtgtagaggagatggaggagaaggcagcccccctgctaaaggaggaaatggcccaccatgccctgctgcgggaatcctgggaggcagcccaggagacctgggaggacaagcgtcgagggcttaccttgccccctggcttcaaagcccagaatggaatagccattatggtctacaccaactcatcgaacaccttgtactgggagttgaatcaggccgtgcggacgggcggaggctcccgggagctctacatgaggcactttcccttcaaggccctgcatttctacctgatccgggccctgcagctgctgcgaggcagtgggggctgcagcaggggacctggggaggtggtgttccgaggtgtgggcagccttcgctttgaacccaagaggctgggggactctgtccgcttgggccagtttgcctccagctccctggataaggcagtggcccacagatttggtaatgccaccctcttctctctaacaacttgctttggggcccctatacaggccttctctgtctttcccaaggagcgcgaggtgctgattcccccccatgaagtctttttggttaccagattctctcaggatggagcccagagcttggtgactctctggagctataatcagacctgtagccattttaactgcgcctatctgggtggggagaagaggcggggctgtgtgtctgcgccaggagccctgggaacgggtgaccttcatatgacgaagaggcacctccagcagccttga
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,963 Da
NCBI Official Full Name
Homo sapiens ADP-ribosyltransferase 5, mRNA
NCBI Official Synonym Full Names
ADP-ribosyltransferase 5
NCBI Official Symbol
ART5
NCBI Official Synonym Symbols
ARTC5
NCBI Protein Information
ecto-ADP-ribosyltransferase 5
UniProt Protein Name
Ecto-ADP-ribosyltransferase 5
UniProt Gene Name
ART5
UniProt Synonym Gene Names
ARTC5
UniProt Entry Name
NAR5_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

ART5: belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Transcript variants with different 5' UTRs, but encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Protein type: Transferase; Secreted, signal peptide; Hydrolase; EC 2.4.2.31; Secreted

Chromosomal Location of Human Ortholog: 11p15.4

Similar Products

Product Notes

The ART5 art5 (Catalog #AAA1269427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgg cggctttgat gatcgccctc ggcagcctcg gcctccacac ctggcaggcc caggctgttc ccaccatcct gcccctgggc ctggctccag acacctttga cgatacctat gtgggttgtg tagaggagat ggaggagaag gcagcccccc tgctaaagga ggaaatggcc caccatgccc tgctgcggga atcctgggag gcagcccagg agacctggga ggacaagcgt cgagggctta ccttgccccc tggcttcaaa gcccagaatg gaatagccat tatggtctac accaactcat cgaacacctt gtactgggag ttgaatcagg ccgtgcggac gggcggaggc tcccgggagc tctacatgag gcactttccc ttcaaggccc tgcatttcta cctgatccgg gccctgcagc tgctgcgagg cagtgggggc tgcagcaggg gacctgggga ggtggtgttc cgaggtgtgg gcagccttcg ctttgaaccc aagaggctgg gggactctgt ccgcttgggc cagtttgcct ccagctccct ggataaggca gtggcccaca gatttggtaa tgccaccctc ttctctctaa caacttgctt tggggcccct atacaggcct tctctgtctt tcccaaggag cgcgaggtgc tgattccccc ccatgaagtc tttttggtta ccagattctc tcaggatgga gcccagagct tggtgactct ctggagctat aatcagacct gtagccattt taactgcgcc tatctgggtg gggagaagag gcggggctgt gtgtctgcgc caggagccct gggaacgggt gaccttcata tgacgaagag gcacctccag cagccttga. It is sometimes possible for the material contained within the vial of "ART5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.