ARMC9 cdna clone
ARMC9 cDNA Clone
Gene Names
ARMC9; ARM; NS21; KU-MEL-1
Synonyms
ARMC9; ARMC9 cDNA Clone; ARMC9 cdna clone
Sequence
atggtgcacccctcatttaaagaactcttccaggattcctggactccagagttaaagttgaagttggaaaagtttctagctttaatatctaaagccagcaacacgccaaagcttttaacaatatataaggagaatggacaaagtaacaaagaaatcttgcagcagctccaccagcagctggttgaagctgaacgtaggtcagtgacatacctcaaacggtacaataagatccaggccgactaccacaatctcattggagtcacagcagagctggtggattctctagaggccacagtcagcggcaagatgatcacccctgagtacctccagagcgtctgtgtccgcctgttcagtaaccagatgcggcagagcctggcgcatagtgtggacttcacgaggcctgggacggcatccaccatgttacgagcctccttggcacccgtgaaattgaaggatgtcccattactgccctccttggattatgagaaactgaagaaggatttgattttggggagtgaccgcttgaaagccttcttgttgcaggctctgcgctggcgcttgaccacatcccatcctggagagcagagggagaccgttctgcaagcctacatcagcaatgacctcttggactgttatagccacaaccagaggagtgtgcttcagttgctgcactccacgagcgacgtggtgcggcagtacatggccaggctcatcaatgcttttgcgtcactggcagaaggtcgcctctaccttgcccagaacacaaaggtgctgcagatgctggagggaaggctgaaggaggaggacaaggatatcatcaccagggagaatgttcttggggccctgcagaagttcagtctcaggcgcccgctgcagacagcgatgattcaagacggcctcatcttctggctggttgatgttctgaaggaccctgactgcctgtctgactacacgctggagtactcggtggctttgctcatgaacctctgcctccgcagcacagggaagaacatgtgtgccaaggtggcaggcctcgtgctcaaagtcctttcggatcttcttggccatgaaaaccatgagatacagccgtatgtgaatggagctctgtacagcatcctttctgttccatccattcgtgaggaagcaagagcaatgggaatggaagacatcctacgctgcttcatcaaagaaggcaatgctgaaatgatccgccagatagaattcatcatcaagcagctaaattccgaagagctaccagatggtgttcttgaatctgatgatgatgaagatgaagatgatgaagaggaccatgacatcatggaagccgatctggacaaagacgaactgatccagccccagcttggagaactctcaggagagaagcttctgaccacagagtacctggggatcatgaccaacacggggaagacaaggcggaaggggctggctaatgtgcagtggagcggggatgagcccctgcaaaggcccgtcacccccggcggccacagaaacgggtacccagtgtaa
Sequence Length
1527
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,579 Da
NCBI Official Full Name
Homo sapiens armadillo repeat containing 9, mRNA
NCBI Official Synonym Full Names
armadillo repeat containing 9
NCBI Official Symbol
ARMC9
NCBI Official Synonym Symbols
ARM; NS21; KU-MEL-1
NCBI Protein Information
lisH domain-containing protein ARMC9
UniProt Protein Name
LisH domain-containing protein ARMC9
Protein Family
UniProt Gene Name
ARMC9
UniProt Synonym Gene Names
KIAA1868
UniProt Entry Name
ARMC9_HUMAN
Uniprot Description
ARMC9: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2q37.1
Research Articles on ARMC9
Similar Products
Product Notes
The ARMC9 armc9 (Catalog #AAA1269965) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcacc cctcatttaa agaactcttc caggattcct ggactccaga gttaaagttg aagttggaaa agtttctagc tttaatatct aaagccagca acacgccaaa gcttttaaca atatataagg agaatggaca aagtaacaaa gaaatcttgc agcagctcca ccagcagctg gttgaagctg aacgtaggtc agtgacatac ctcaaacggt acaataagat ccaggccgac taccacaatc tcattggagt cacagcagag ctggtggatt ctctagaggc cacagtcagc ggcaagatga tcacccctga gtacctccag agcgtctgtg tccgcctgtt cagtaaccag atgcggcaga gcctggcgca tagtgtggac ttcacgaggc ctgggacggc atccaccatg ttacgagcct ccttggcacc cgtgaaattg aaggatgtcc cattactgcc ctccttggat tatgagaaac tgaagaagga tttgattttg gggagtgacc gcttgaaagc cttcttgttg caggctctgc gctggcgctt gaccacatcc catcctggag agcagaggga gaccgttctg caagcctaca tcagcaatga cctcttggac tgttatagcc acaaccagag gagtgtgctt cagttgctgc actccacgag cgacgtggtg cggcagtaca tggccaggct catcaatgct tttgcgtcac tggcagaagg tcgcctctac cttgcccaga acacaaaggt gctgcagatg ctggagggaa ggctgaagga ggaggacaag gatatcatca ccagggagaa tgttcttggg gccctgcaga agttcagtct caggcgcccg ctgcagacag cgatgattca agacggcctc atcttctggc tggttgatgt tctgaaggac cctgactgcc tgtctgacta cacgctggag tactcggtgg ctttgctcat gaacctctgc ctccgcagca cagggaagaa catgtgtgcc aaggtggcag gcctcgtgct caaagtcctt tcggatcttc ttggccatga aaaccatgag atacagccgt atgtgaatgg agctctgtac agcatccttt ctgttccatc cattcgtgag gaagcaagag caatgggaat ggaagacatc ctacgctgct tcatcaaaga aggcaatgct gaaatgatcc gccagataga attcatcatc aagcagctaa attccgaaga gctaccagat ggtgttcttg aatctgatga tgatgaagat gaagatgatg aagaggacca tgacatcatg gaagccgatc tggacaaaga cgaactgatc cagccccagc ttggagaact ctcaggagag aagcttctga ccacagagta cctggggatc atgaccaaca cggggaagac aaggcggaag gggctggcta atgtgcagtg gagcggggat gagcccctgc aaaggcccgt cacccccggc ggccacagaa acgggtaccc agtgtaa. It is sometimes possible for the material contained within the vial of "ARMC9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
