Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGEF16 cdna clone

ARHGEF16 cDNA Clone

Gene Names
ARHGEF16; NBR; GEF16
Synonyms
ARHGEF16; ARHGEF16 cDNA Clone; ARHGEF16 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcgagatcctcacgtcggagttctcctaccagcacagcctgagcatcctggtggaggagttcctgcagtccaaggagctgcgggcgaccgtgacccagatggagcaccaccacctcttctccaacatcctggatgtcctgggtgccagtcagaggttcttcgaggacctggagcagcggcacaaggcccaggtgctggtcgaggacatcagtgacatcctggaggagcacgctgagaagcacttccacccctacatcgcctactgctccaacgaggtctaccaacagcgcacgctgcagaagctgataagcagcaacgccgccttccgagaggccctgagagagattgagaggcggccggcgtgcgggggcctgcccatgctctccttcctgatcctccccatgcagcgggtgacccggctgcccctcctgatggatacgctctgcctcaagacccagggccactccgaaaggtacaaggctgccagccgtgcactgaaggccatcagcaagctggtgaggcagtgcaacgagggggcccacaggatggagcgcatggagcagatgtacacgctgcacacacagctggacttcagcaaggtcaagtctctcccactgatctccgcctcccggtggctgctgaagcgcggagagctgttcttagtggaagaaaccggactttttcgaaaaattgccagccggccaacgtgctaccttttcctgttcaacgatgtcctggttgtgaccaagaagaagagcgaggagagctacatggtccaggactacgcccagatgaaccacatccaggtggagaagatagagccgtctgagctccctctgcccgggggcggcaaccgtagctcctccgtgccccaccccttccaggtgaccctgcttcgcaacagcgagggccgccaggagcagctcctgctctcctcggactccgcgagtgaccgggcacggtggatcgtggcgctcacacacagtgagagacagtggcagggcctctccagcaaaggagacctgccccaggtggagatcaccaaggccttcttcgcgaagcaagcagacgaggtcacactgcagcaggcggacgtggtcctggttctgcagcaggaggatgggtggctctatggcgagaggctccgggacggagagacgggatggttccccgaggactttgcccgcttcatcaccagccgtgtggccgtggagggcaatgtccgcaggatggagcgtctgcgggtggagacggacgtgtag
Sequence Length
1266
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,629 Da
NCBI Official Full Name
Homo sapiens Rho guanine exchange factor (GEF) 16, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 16
NCBI Official Symbol
ARHGEF16
NCBI Official Synonym Symbols
NBR; GEF16
NCBI Protein Information
rho guanine nucleotide exchange factor 16
UniProt Protein Name
Rho guanine nucleotide exchange factor 16
UniProt Gene Name
ARHGEF16
UniProt Synonym Gene Names
EPHEXIN4; NBR
UniProt Entry Name
ARHGG_HUMAN

NCBI Description

Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]

Uniprot Description

ARHGEF16: a Rho guanine exchange factor protein that contains 1 DH, 1 PH and 1 SH3 domain.

Protein type: Motility/polarity/chemotaxis; GEFs, Rac/Rho; GEFs

Chromosomal Location of Human Ortholog: 1p36.3

Cellular Component: cell-cell adherens junction; cytosol

Molecular Function: guanyl-nucleotide exchange factor activity; PDZ domain binding; protein binding; receptor tyrosine kinase binding; Rho GTPase binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: positive regulation of apoptosis; regulation of small GTPase mediated signal transduction

Research Articles on ARHGEF16

Similar Products

Product Notes

The ARHGEF16 arhgef16 (Catalog #AAA1271069) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgaga tcctcacgtc ggagttctcc taccagcaca gcctgagcat cctggtggag gagttcctgc agtccaagga gctgcgggcg accgtgaccc agatggagca ccaccacctc ttctccaaca tcctggatgt cctgggtgcc agtcagaggt tcttcgagga cctggagcag cggcacaagg cccaggtgct ggtcgaggac atcagtgaca tcctggagga gcacgctgag aagcacttcc acccctacat cgcctactgc tccaacgagg tctaccaaca gcgcacgctg cagaagctga taagcagcaa cgccgccttc cgagaggccc tgagagagat tgagaggcgg ccggcgtgcg ggggcctgcc catgctctcc ttcctgatcc tccccatgca gcgggtgacc cggctgcccc tcctgatgga tacgctctgc ctcaagaccc agggccactc cgaaaggtac aaggctgcca gccgtgcact gaaggccatc agcaagctgg tgaggcagtg caacgagggg gcccacagga tggagcgcat ggagcagatg tacacgctgc acacacagct ggacttcagc aaggtcaagt ctctcccact gatctccgcc tcccggtggc tgctgaagcg cggagagctg ttcttagtgg aagaaaccgg actttttcga aaaattgcca gccggccaac gtgctacctt ttcctgttca acgatgtcct ggttgtgacc aagaagaaga gcgaggagag ctacatggtc caggactacg cccagatgaa ccacatccag gtggagaaga tagagccgtc tgagctccct ctgcccgggg gcggcaaccg tagctcctcc gtgccccacc ccttccaggt gaccctgctt cgcaacagcg agggccgcca ggagcagctc ctgctctcct cggactccgc gagtgaccgg gcacggtgga tcgtggcgct cacacacagt gagagacagt ggcagggcct ctccagcaaa ggagacctgc cccaggtgga gatcaccaag gccttcttcg cgaagcaagc agacgaggtc acactgcagc aggcggacgt ggtcctggtt ctgcagcagg aggatgggtg gctctatggc gagaggctcc gggacggaga gacgggatgg ttccccgagg actttgcccg cttcatcacc agccgtgtgg ccgtggaggg caatgtccgc aggatggagc gtctgcgggt ggagacggac gtgtag. It is sometimes possible for the material contained within the vial of "ARHGEF16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.