Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGDIA cdna clone

ARHGDIA cDNA Clone

Gene Names
ARHGDIA; GDIA1; NPHS8; RHOGDI; RHOGDI-1; HEL-S-47e
Synonyms
ARHGDIA; ARHGDIA cDNA Clone; ARHGDIA cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagcaggagcccacagccgagcagctggcccagattgcagcggagaacgaggaggatgagcactcggtcaactacaagcccccggcccagaagagcatccaggagatccaggagctggacaaggacgacgagagcctgcgaaagtacaaggaggccctgctgggccgcgtggccgtttccgcagaccccaacgtccccaacgtcgtggtgactggcctgaccctggtgtgcagctcggccccgggccccctggagctggacctgacgggcgacctggagagcttcaagaagcagtcgtttgtgctgaaggagggtgtggagtaccggataaaaatctctttccgggttaaccgagagatagtgtccggcatgaagtacatccagcatacgtacaggaaaggcgtcaagattgacaagactgactacatggtaggcagctatgggccccgggccgaggagtacgagttcctgacccccgtggaggaggcacccaagggtatgctggcccggggcagctacagcatcaagtcccgcttcacagacgacgacaagaccgaccacctgtcctgggagtggaatctcaccatcaagaaggactggaaggactga
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
396
Molecular Weight
18,233 Da
NCBI Official Full Name
Homo sapiens Rho GDP dissociation inhibitor (GDI) alpha, mRNA
NCBI Official Synonym Full Names
Rho GDP dissociation inhibitor alpha
NCBI Official Symbol
ARHGDIA
NCBI Official Synonym Symbols
GDIA1; NPHS8; RHOGDI; RHOGDI-1; HEL-S-47e
NCBI Protein Information
rho GDP-dissociation inhibitor 1
UniProt Protein Name
Rho GDP-dissociation inhibitor 1
UniProt Gene Name
ARHGDIA
UniProt Synonym Gene Names
GDIA1; Rho GDI 1
UniProt Entry Name
GDIR1_HUMAN

NCBI Description

This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

RhoGDI alpha: Regulates the GDP/GTP exchange reaction of the Rho proteins by inhibiting the dissociation of GDP from them, and the subsequent binding of GTP to them. Monomer. Forms a heterodimer with RAC1. Interacts with FER. Belongs to the Rho GDI family.

Protein type: Motility/polarity/chemotaxis; Cell development/differentiation; Apoptosis; Cell adhesion; G protein regulator, misc.

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytoskeleton; cytosol

Molecular Function: protein binding

Biological Process: cell motility; negative regulation of apoptosis; negative regulation of axonogenesis; negative regulation of cell adhesion; positive regulation of axonogenesis; regulation of Rho protein signal transduction; regulation of small GTPase mediated signal transduction

Disease: Nephrotic Syndrome, Type 8

Research Articles on ARHGDIA

Similar Products

Product Notes

The ARHGDIA arhgdia (Catalog #AAA1278718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagc aggagcccac agccgagcag ctggcccaga ttgcagcgga gaacgaggag gatgagcact cggtcaacta caagcccccg gcccagaaga gcatccagga gatccaggag ctggacaagg acgacgagag cctgcgaaag tacaaggagg ccctgctggg ccgcgtggcc gtttccgcag accccaacgt ccccaacgtc gtggtgactg gcctgaccct ggtgtgcagc tcggccccgg gccccctgga gctggacctg acgggcgacc tggagagctt caagaagcag tcgtttgtgc tgaaggaggg tgtggagtac cggataaaaa tctctttccg ggttaaccga gagatagtgt ccggcatgaa gtacatccag catacgtaca ggaaaggcgt caagattgac aagactgact acatggtagg cagctatggg ccccgggccg aggagtacga gttcctgacc cccgtggagg aggcacccaa gggtatgctg gcccggggca gctacagcat caagtcccgc ttcacagacg acgacaagac cgaccacctg tcctgggagt ggaatctcac catcaagaag gactggaagg actga. It is sometimes possible for the material contained within the vial of "ARHGDIA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.