ARHGAP26 cdna clone

ARHGAP26 cDNA Clone

Gene Names

ARHGAP26; GRAF; GRAF1; OPHN1L; OPHN1L1

Synonyms

ARHGAP26; ARHGAP26 cDNA Clone; ARHGAP26 cdna clone

Ordering
Cat. Num. AAA1268612 For Research Use Only!

Sequence

atggggctcccagcgctcgagttcagcgactgctgcctcgatagtccgcacttccgagagacgctcaagtcgcacgaagcagagctggacaagaccaacaaattcatcaaggagctcatcaaggacgggaagtcactcataagcgcgctcaagaatttgtcttcagcgaagcggaagtttgcagattccttaaatgaatttaaatttcagtgcataggagatgcagaaacagatgatgagatgtgtatagcaaggtctttgcaggagtttgccactgtcctcaggaatcttgaagatgaacggatacggatgattgagaatgccagcgaggtgctcatcactcccttggagaagtttcgaaaggaacagatcggggctgccaaggaagccaaaaagaagtatgacaaagagacagaaaagtattgtggcatcttagaaaaacacttgaatttgtcttccaaaaagaaagaatctcagcttcaggaggcagacagccaagtggacctggtccggcagcatttctatgaagtatccctggaatatgtcttcaaggtgcaggaagtccaagagagaaagatgtttgagtttgtggagcctctgctggccttcctgcaaggactcttcactttctatcaccatggttacgaactggccaaggatttcggggacttcaagacacagttaaccattagcatacagaacacaagaaatcgctttgaaggcactagatcagaagtggaatcactgatgaaaaagatgaaggagaatccccttgagcacaagaccatcagtccctacaccatggagggatacctctacgtgcaggagaaacgtcactttggaacttcttgggtgaagcactactgtacatatcaacgggattccaaacaaatcaccatggtaccatttgaccaaaagtcaggaggaaaagggggagaagatgaatcagttatcctcaaatcctgcacacggcggaaaacagactccattgagaagaggttttgctttgatgtggaagcagtagacaggccaggggttatcaccatgcaagctttgtcggaagaggaccggaggctctggatggaagccatggatggccgggaacctgtctacaactcgaacaaagacagccagagtgaagggactgcgcagttggacagcattggcttcagcataatcaggaaatgcatccatgctgtggaaaccagagggatcaacgagcaagggctgtatcgaattgtgggggtcaactccagagtgcagaagttgctgagtgtcctgatggaccccaagactgcttctgagacagaaacagatatctgtgctgaatgggagataaagaccatcactagtgctctgaagacctacctaagaatgcttccaggaccactcatgatgtaccagtttcaaagaagtttcatcaaagcagcaaaactggagaaccaggagtctcgggtctctgaaatccacagccttgttcatcggctcccagagaaaaatcggcagatgttacagctgctcatgaaccacttggcaaatgttgctaacaaccacaagcagaatttgatgacggtggcaaaccttggtgtggtgtttggacccactctgctgaggcctcaggaagaaacagtagcagccatcatggacatcaaatttcagaacattgtcattgagatcctaatagaaaaccacgaaaagatatttaacaccgtgcccgatatgcctctcaccaatgcccagctgcacctgtctcggaagaagagcagtgactccaagcccccgtcctgcagcgagaggcccctgacgctcttccacaccgttcagtcaacagagaaacaggaacaaaggaacagcatcatcaactccagtttggaatctgtctcatcaaatccaaacagcatccttaattccagcagcagcttacagcccaacatgaactccagtgacccagacctggctgtggtcaaacccacccggcccaactcactccccccgaatccaagcccaacttcacccctctcgccatcttggcccatgttctcggcgccatccagccctatgcccacctcatccacgtccagcgactcatcccccgtcagcacaccgttccggaaggcaaaagccttgtatgcctgcaaagctgaacatgactcagaactttcgttcacagcaggcacggtcttcgataatgttcacccatctcaggagcctggctggttggaggggactctgaacggaaagactggcctcatccctgagaattacgtggagttcctctaa

Sequence Length

2280

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

46249802

NCBI GeneID

23092

Molecular Weight

86,165 Da

NCBI Official Full Name

Homo sapiens Rho GTPase activating protein 26, mRNA

NCBI Official Synonym Full Names

Rho GTPase activating protein 26

NCBI Official Symbol

ARHGAP26

NCBI Official Synonym Symbols

GRAF; GRAF1; OPHN1L; OPHN1L1

NCBI Protein Information

rho GTPase-activating protein 26

UniProt Protein Name

Rho GTPase-activating protein 26

Protein Family

Rho GTPase-activating protein

UniProt Gene Name

ARHGAP26

UniProt Synonym Gene Names

GRAF; KIAA0621; OPHN1L

UniProt Entry Name

RHG26_HUMAN

NCBI Description

Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

Uniprot Description

ARHGAP26: GTPase-activating protein for RHOA and CDC42. Interacts with NYAP1, NYAP2 and MYO16. Binds to the C-terminus of PTK2/FAK1. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oncoprotein; GAPs; Motility/polarity/chemotaxis; GAPs, Rac/Rho

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytosol

Molecular Function: GTPase activator activity; phospholipid binding; protein binding

Biological Process: regulation of small GTPase mediated signal transduction

Disease: Juvenile Myelomonocytic Leukemia

Research Articles on ARHGAP26

1. GRAF expression is a favorable prognostic marker in patients with acute myeloid leukemia.

Similar Products

Product Notes

The ARHGAP26 arhgap26 (Catalog #AAA1268612) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctcc cagcgctcga gttcagcgac tgctgcctcg atagtccgca cttccgagag acgctcaagt cgcacgaagc agagctggac aagaccaaca aattcatcaa ggagctcatc aaggacggga agtcactcat aagcgcgctc aagaatttgt cttcagcgaa gcggaagttt gcagattcct taaatgaatt taaatttcag tgcataggag atgcagaaac agatgatgag atgtgtatag caaggtcttt gcaggagttt gccactgtcc tcaggaatct tgaagatgaa cggatacgga tgattgagaa tgccagcgag gtgctcatca ctcccttgga gaagtttcga aaggaacaga tcggggctgc caaggaagcc aaaaagaagt atgacaaaga gacagaaaag tattgtggca tcttagaaaa acacttgaat ttgtcttcca aaaagaaaga atctcagctt caggaggcag acagccaagt ggacctggtc cggcagcatt tctatgaagt atccctggaa tatgtcttca aggtgcagga agtccaagag agaaagatgt ttgagtttgt ggagcctctg ctggccttcc tgcaaggact cttcactttc tatcaccatg gttacgaact ggccaaggat ttcggggact tcaagacaca gttaaccatt agcatacaga acacaagaaa tcgctttgaa ggcactagat cagaagtgga atcactgatg aaaaagatga aggagaatcc ccttgagcac aagaccatca gtccctacac catggaggga tacctctacg tgcaggagaa acgtcacttt ggaacttctt gggtgaagca ctactgtaca tatcaacggg attccaaaca aatcaccatg gtaccatttg accaaaagtc aggaggaaaa gggggagaag atgaatcagt tatcctcaaa tcctgcacac ggcggaaaac agactccatt gagaagaggt tttgctttga tgtggaagca gtagacaggc caggggttat caccatgcaa gctttgtcgg aagaggaccg gaggctctgg atggaagcca tggatggccg ggaacctgtc tacaactcga acaaagacag ccagagtgaa gggactgcgc agttggacag cattggcttc agcataatca ggaaatgcat ccatgctgtg gaaaccagag ggatcaacga gcaagggctg tatcgaattg tgggggtcaa ctccagagtg cagaagttgc tgagtgtcct gatggacccc aagactgctt ctgagacaga aacagatatc tgtgctgaat gggagataaa gaccatcact agtgctctga agacctacct aagaatgctt ccaggaccac tcatgatgta ccagtttcaa agaagtttca tcaaagcagc aaaactggag aaccaggagt ctcgggtctc tgaaatccac agccttgttc atcggctccc agagaaaaat cggcagatgt tacagctgct catgaaccac ttggcaaatg ttgctaacaa ccacaagcag aatttgatga cggtggcaaa ccttggtgtg gtgtttggac ccactctgct gaggcctcag gaagaaacag tagcagccat catggacatc aaatttcaga acattgtcat tgagatccta atagaaaacc acgaaaagat atttaacacc gtgcccgata tgcctctcac caatgcccag ctgcacctgt ctcggaagaa gagcagtgac tccaagcccc cgtcctgcag cgagaggccc ctgacgctct tccacaccgt tcagtcaaca gagaaacagg aacaaaggaa cagcatcatc aactccagtt tggaatctgt ctcatcaaat ccaaacagca tccttaattc cagcagcagc ttacagccca acatgaactc cagtgaccca gacctggctg tggtcaaacc cacccggccc aactcactcc ccccgaatcc aagcccaact tcacccctct cgccatcttg gcccatgttc tcggcgccat ccagccctat gcccacctca tccacgtcca gcgactcatc ccccgtcagc acaccgttcc ggaaggcaaa agccttgtat gcctgcaaag ctgaacatga ctcagaactt tcgttcacag caggcacggt cttcgataat gttcacccat ctcaggagcc tggctggttg gaggggactc tgaacggaaa gactggcctc atccctgaga attacgtgga gttcctctaa. It is sometimes possible for the material contained within the vial of "ARHGAP26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ARHGAP26 cdna clone